Foreign particles circulating in the blood are filtered by the ____________.

Biology

1 answer:

babunello [35]3 years ago

6 0

Answer:

spleen is a correct answer.

Explanation:

Foreign particles circulating in the blood are filtered by the spleen

Spleen is present in the upper left area of the abdomen.

Spleen function is to filter the foreign particles from the blood as it acts as a blood filter.

Spleen recognizes the damage and old red blood cells, foreign particles.

As the blood flows into the spleen the white blood cell present remove and they attack the foreign particles.

Spleen acts as a blood filter by this way foreign particle are removed and the blood is filtered.

Thus(spleen) is a correct answer.

You might be interested in

HELO! This is photosynthesis

7nadin3 [17]

Answer:

Explanation:

thermal means heat

3 0

3 years ago

The conserved part of polypeptide chain that can independently fold with respect to an entire protein is

mezya [45]

Killerbee is the best

3 0

4 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved