1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SIZIF [17.4K]
3 years ago
9

What makes aftershocks so problematic

Biology
1 answer:
katrin2010 [14]3 years ago
6 0
They can provide almost as much damage as an earthquake. 
Hope this helps!!
:D
You might be interested in
Which water type is densest?
blondinia [14]
The answer is D.cold, non-saline water
4 0
4 years ago
Read 2 more answers
Examine the incomplete graphic pictured above. Which label belongs in box 3?A-Fungi B-Protista D-Eubacteri C-Eukarya Will give B
Rzqust [24]
B is the only one that doesn’t fit























3 0
3 years ago
Plssss help me on this
solong [7]
The answer is the third one

7 0
4 years ago
Read 2 more answers
What effects can an invasive species have on an ecosystem?Choose all that apply
gogolik [260]

Answer:

It should be D.

Explanation:

The invasive species will negatively effect the ecosystem and the natural predator in the area. Like the Blue Lobster problem in Maine.

6 0
3 years ago
Read 2 more answers
Which of the following is the equation for acceleration?
belka [17]

Answer:b.

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • What structure is essential for the transport of specific large molecules in and out of cells?
    9·1 answer
  • At which trophic level do decomposers work
    8·1 answer
  • The element_____ Is found in all organic compounds
    5·2 answers
  • If the swelling of otitis media becomes severe, it may perforate the _____.
    14·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • A scientist discovers a cell that has chloroplasts, cytoplasm, DNA, and a cell membrane. Which statement best describes how the
    7·2 answers
  • Which is true of hydroxide ions?
    6·2 answers
  • Which of the following is a risk of
    14·1 answer
  • Can create a horizontal, spinning column near Earth's surface, eventually turning into a vertical tornado.
    11·2 answers
  • Identify the location of the majority of triglyceride digestion.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!