<span> B. lichens and mosses, fir and birch, small herbs and shrubs, pine and spruce</span>
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
What about transport you might ask well
in plants, how does a Redwood, one of the tallest trees in the world, move water from the soil to the needles on its tallest branches over 300 ft in the air? (That’s over 30 stories high!) Or how does a carrot transport the sugars made in its green, leafy tops below the surface of the soil to grow a sweet, orange taproot? Well, certain types of plants (vascular plants) have a system for transporting water, minerals, and nutrients (food!) throughout their bodies; it’s called the vascular system. Think of it as the plant’s plumbing, which is made up of cells that are stacked on top of one another to form long tubes from the tip of the root to the top of the plant. To learn more about it, let’s study the stem.
Answer:
B: Polyermase Chain Reaction
Explanation:
PCR is when we take a segment of DNA and multiply it! We can see that the number of DNA segments are increasing therefore it is PCR. Hope this helps!
Answer:
d coal
Explanation:
i need more words for it to let me post this answer blah blah
