1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Phoenix [80]
3 years ago
15

How has the definition of culture changed over time?

Biology
2 answers:
KIM [24]3 years ago
8 0

The attitudes, customs, and beliefs, which are the part of the society form the culture of the people. The culture is distinctive to each group of individuals and illustrates who they are. Though, under the right conditions, the definitions of the culture can modify.  

The change in the definition of the culture can take place from within, that is, via novel technological advancement or philosophical ideas. Another way by which the definition of culture can modify is via coming in contact with other cultures. When contact takes place between the two cultures, diffusion may take place. Diffusion refers to the conduction of ideas among the cultures.  


Nitella [24]3 years ago
3 0
Diffusion between cultures has occurred and changed the meaning of culture. As time progresses, people grow and change and technology progresses as well, ultimately changing how culture is and develops.
You might be interested in
Under what two types of plates is the oceanic lithosphere being subducted?
morpeh [17]
Plates include both oceanic crust and continental crust. Stable subduction zones involve the oceanic lithosphere of one plate sliding beneath the continental or oceanic lithosphere of another plate due to the higher density of the oceanic lithosphere.
4 0
3 years ago
During photosynthesis, plants take in light energy from the Sun, carbon dioxide from the air, and water through their roots. Whi
Diano4ka-milaya [45]
During photosynthesis, plants take in light energy from the Sun, carbon dioxide from the air, and water through their roots. Oxygen is a product of photosynthesis.
3 0
3 years ago
Explain why cold-blooded organisms like reptiles have a higher rate of secondary productivity than warm-blooded mammals.
PIT_PIT [208]
Warm-blooded creatures, like mammals and birds, try to keep the inside of their bodies at a constant temperature. They do this by generating their own heat when they are in a cooler environment, and by cooling themselves when they are in a hotter environment. To generate heat, warm-blooded animals convert the food that they eat into energy. They have to eat a lot of food, compared with cold-blooded animals, to maintain a constant body temperature. Only a small amount of the food that a warm-blooded animal eats is converted into body mass. The rest is used to fuel a constant body temperature.
7 0
3 years ago
Read 2 more answers
Is transcription the location of translation and protein synthesis
Ivahew [28]
The ribosome is the location of translation, while transcription always takes place in the nucleus.
8 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • T lymphocytes are responsible for ________ and maturation occurs in the ______ Group of answer choices the humoral immune respon
    8·1 answer
  • A friend declares that chromosomes are held at the metaphase plate by microtubules that push on each chromosome from opposite si
    10·1 answer
  • Amino acids are used to build?
    7·2 answers
  • The distance from Earth to the Sun is 1.0 _____.
    11·1 answer
  • Honey vs Sugar which is healthier and why?
    5·1 answer
  • The zebra mussel is originally native to the Black and Caspian Seas of Asia. Zebra mussels were first detected in the Hudson Riv
    11·1 answer
  • How does one determine when an ecosystem is in balance
    11·2 answers
  • Match each description with the correct ecosystem.
    11·2 answers
  • In rats, offspring of larger mothers tend to be larger than offspring of smaller mothers, even when fed the same diet and raised
    9·1 answer
  • Looking at the graph (photo attached), what is the independent and dependent variable?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!