Answer:
1) The general characteristics of kingdom plantae are as follows −. Multicellular organisms with walled and frequently vacuolated. Eukaryotic cells. Contain photosynthetic pigments which are present in plastids. They are autotrophic mode of nutrition. Plants are non-motile, live anchored to a substrate. Autotrophic
: All plants are autotrophic, making and producing their own food and nutrients, without needing others to provide it for them.
Multicellular
: All plants all multicellular, meaning they are composed of more than one cell, which is what makes them visible to our naked eyes.
Eukaryotic: All plants are eukaryotic, meaning their cells all contain a nucleus, which is one of the organelles of the cell surrounded in a cell membrane. four characteristics that distinguish land plants from charophyte algae.
2) Alternation of generations (w/ an associated trait of multicellular, dependent embryos), walled spores produced in sporangia, multicellular gametangia, and apical meristems. These are evolved traits of land plants. Not all plants have retained these traits.
Explanation:
I added explanations inside the answer. I hope it make sense.
Answer:
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
TTAAGCGGCCATAATCTGCAA
Explanation:
The sentence which is true or a fact about the virus is the sentence in letter B. Viruses can reproduce only within other cells. <span>Viruses are intracellular obligate parasites they can not replicate or express the genes with out living host. </span>
<span>viruses are acellular so they have to rely on host cellular machinery for reproduction. </span>
<span>viruses doesnot contain any enzymes for reproduction</span>
Answer:
Sadness has sad feeling. for example, if a friend dies, you will cry. that is what sadness is.
Explanation:
Answer:
Fossil evidence shows that vertebrates made the transition from water to land during the <u>DEVONIAN</u> period.
<u>SALAMANDERS</u> are amphibians that most closely resemble early tetrapods in body form with a long tail and 4 limbs of similar length.
A distinctive characteristic of mammals that is not observed in other vertebrates is <u>ENDOTHERMY</u>.
By the end of the <u>CAMBRIAN </u>period, all major animal lineages were present in the seas due to a great adaptive radiation of animals.
The vertebrate lung first appeared in <u>AMPHIBIANS</u>
Explanation:
Vertebrates started to transition from water to land later in the Devonian period. The vertebrates had to adjust to living on land such as withstanding gravity, breathing in air, adjusting senses to living on land than on water, and significant water loss due to the new environment. This was a big step in the realm of evolution because vertebrates were now able to thrive because they are no longer limited to the resources and space of water.
Salamaders are said to have not evolved much and have some characteristics that resemble early tetrapods. Regeneration of limbs is one of the salamanders unique capability which early tetrapods possessed.
Amphibians are ectotherms, which means they get their energy outside their body or their source of heat would be the heat from the environment. Amphibians and reptiles are ectotherms, and mammals are endotherms. Endotherms can generate heat internally.
The Cambrian period marks the Cambrian Explosion. According to fossil records modern organisms evolved rapidly and soon after split into different phyla due to adaptive radiation as a result of the extinction of dinosaurs.
The evolution of lungs is one of the most important changes in vertebrates which allowed early amphibians of water to move to land. It enabled them to breath air.
