Answer:
Cytokinesis
Explanation:
After meiosis I finishes, the cell splits in a period called cytokinesis. Each cell then has half the original number of chromosomes.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer:
B
Explanation:
only plants convert solar energy to chemical energy.
Answer:
Explanation:
Genes contain specific instructions for how to make proteins within the body.
Epigenetic changes are generally heritable genetic changes that are due to environmental factors, which work by turning genes that already exist in the body 'on' or 'off' depending on these factors.
Meiosis produces gamete cells. This is usually a total of 4 gamete cells which are all part of producing everything required in the reproductive process.
exposure to extreme heat is probably the most likely cause of mutation for E. Coli as it needs a steady 36–40°C for survival.
Changes to body cells affect cell division. This is because genetic mutations cause cells that are designed for normal cell growth to greatly increase which can throw the system off and cause many problems.
