1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitry [639]
3 years ago
14

5. The scientific term for chewing food is

Biology
2 answers:
Shtirlitz [24]3 years ago
7 0

Answer:

c. mastication

Explanation:

The scientific term for chewing food is mastication.

Mastication is the mechanical grinding of food into tiny pieces by the teeth. Mastication is essentially the scientific term for “chewing”

Mice21 [21]3 years ago
4 0

The scientific term for chewing food is mastication.

Option C

<u>Explanation</u>:  

The food splits into smaller pieces during mastication. As the food is broken down its surface area increases as the size decreases due to which many other enzymes can also act on the masticated food.

Mixing of enzymes occur both during mastication and after mastication. The food is passed down through oesophagus into the stomach where other enzymes and acids are mixed to breakdown the food into further smaller molecules.

You might be interested in
2. What are individual characteristics? Give an example of an individual characteristic?
kvv77 [185]

Answer:

Individual Characteristics are properties of physical evidence that can be attributed to a common source with a high degree of certainty. Examples of individual evidence include anything that contains nuclear DNA, toolmarks, and fingerprints.

Explanation:

4 0
3 years ago
Read 2 more answers
A test cross can be used to _____.
gtnhenbr [62]

Answer: - Predict an unknown genotype of a purebred dominant plant.

Explanation:

The genetic make up of the organism is called as the genotype. It describes the form of genes or allelic forms present in the organism. A test cross is used to determine the genotype of the organism. In this cross the organism with the unknown genotype is done with that of the organism with the known genotype. It also determines the fact that the organism is either homozygous dominant or hetrozygous.

On the basis of the above description, Predict an unknown genotype of a purebred dominant plant.

8 0
3 years ago
Biology b adaptive
Maslowich

The substance namely water is moved through hydrologic cycle. The correct option is A.

<h3>What is hydrologic cycle?</h3>

The hydrologic cycle is the continual movement of water in the Earth-Atmosphere system.

The water cycle is defined as the movement of water from the Earth to the atmosphere and back again.

As per the question, the substance namely water is moved through hydrologic cycle.

Thus, the correct option is A.

For more details regarding hydrologic cycle, visit:

brainly.com/question/13554728

#SPJ1

8 0
2 years ago
Which of the following occurs after a condon and anticondon form hydrogen bonds<br><br>​
xxTIMURxx [149]

Answer:

Anticodon. The anticodon region of a transfer RNA is a sequence of three bases that are complementary to a codon in the messenger RNA. During translation , the bases of the anticodon form complementary base pairs witht the bases of the codon by forming the appropriate hydrogen bonds.

8 0
4 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • The cell membrane _____. is made of phospholipids is a single layer is embedded with proteins controls the transfer of materials
    6·2 answers
  • WILL GIVE BRAINLIST HELP FAST
    14·2 answers
  • The parasympathetic tone ________.
    10·1 answer
  • Which of the following accurately describes immWhich of the following accurately describes immunity?
    10·1 answer
  • What  are  the  major  characteristics  of  the  mollusk<br> phylum
    11·1 answer
  • A student completed a lab report. Which correctly describes the difference between the "Question" and "Hypothesis' sections
    10·2 answers
  • When apparent competition occurs, the:
    13·1 answer
  • What is the process by which heat energy gets to Earth from the Sun<br><br>Raditation
    8·1 answer
  • PLS HELP ASAP Which of the following is the end product of translation?
    14·1 answer
  • WILL GIVE BRILLIANT IF ANSWERED RIGHT
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!