Answer:
Individual Characteristics are properties of physical evidence that can be attributed to a common source with a high degree of certainty. Examples of individual evidence include anything that contains nuclear DNA, toolmarks, and fingerprints.
Explanation:
Answer: - Predict an unknown genotype of a purebred dominant plant.
Explanation:
The genetic make up of the organism is called as the genotype. It describes the form of genes or allelic forms present in the organism. A test cross is used to determine the genotype of the organism. In this cross the organism with the unknown genotype is done with that of the organism with the known genotype. It also determines the fact that the organism is either homozygous dominant or hetrozygous.
On the basis of the above description, Predict an unknown genotype of a purebred dominant plant.
The substance namely water is moved through hydrologic cycle. The correct option is A.
<h3>What is hydrologic cycle?</h3>
The hydrologic cycle is the continual movement of water in the Earth-Atmosphere system.
The water cycle is defined as the movement of water from the Earth to the atmosphere and back again.
As per the question, the substance namely water is moved through hydrologic cycle.
Thus, the correct option is A.
For more details regarding hydrologic cycle, visit:
brainly.com/question/13554728
#SPJ1
Answer:
Anticodon. The anticodon region of a transfer RNA is a sequence of three bases that are complementary to a codon in the messenger RNA. During translation , the bases of the anticodon form complementary base pairs witht the bases of the codon by forming the appropriate hydrogen bonds.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: