1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natasha2012 [34]
3 years ago
9

The collection of all chromosomes in an organism is their what

Biology
1 answer:
lyudmila [28]3 years ago
7 0

Answer:

I believe it's called a genome.

You might be interested in
5.<br> What instrument would a meteorologist use to measure humidity in the air?
storchak [24]
They use a hygrometer. It measures relative humidity (the amount of moisture in the air) A psychrometer is an example of a hydrometer
3 0
3 years ago
Sex chromosomes are:
LenaWriter [7]

Answer:

D. the 23rd pair of chromosomes

Explanation:

Humans have a total of 23 pairs of chromosomes. Out of a total of 23 pairs, 22 pairs are autosomes. Autosomes are the chromosomes that carry the genes for all the genetic traits but are not involved in the sex determination of the individuals.

The 23rd pair of chromosomes in humans is of sex chromosomes as these chromosomes carry the genes to regulate the gender of the individuals. A human female has two copies of the X chromosome as sex chromosomes while human males have one X and one Y chromosome as their sex chromosomes. The Y chromosome carries "SRY" gene that codes for testes determining factor and regulates the development of testes in the embryo.

6 0
3 years ago
Which molecule allows a blade of grass to stand up straight?
Ad libitum [116K]
A. Polysaccharide, this is because polysaccharides have cellulose which make the grass stand up.
8 0
3 years ago
How can scientists use the fossil record to find evidence of relationships between different species?
a_sh-v [17]
Using the fossil record, you can categorize species based on analogous or homologous structures
5 0
3 years ago
Protists are helpful to us because they?
Blizzard [7]

Answer:

B) Help produce oxygen

C) Help make foods

D) Help break down dead materials

Explanation:

B - Life on Earth <em>depends</em> on protists since they are the ones who supply us with oxygen.

C - Provide food to other living organisms in food chains/webs.

D - Even, recycle important nutrients just for other life forms to use (some protists may also be decomposers; as they also release nutrients into the environment).

4 0
3 years ago
Other questions:
  • Which fat has only single bonds between the carbon atoms in the fatty acid?
    13·1 answer
  • Economic benefits of forest​
    8·1 answer
  • Would you say this is a hypothesis or a theory? Think about the difference between a theory and a hypothesis and try to apply it
    6·1 answer
  • 10. What are herbivores? a.They are organisms that require plant material for food, habitat, or reproduction b.They are organism
    5·2 answers
  • What is the answer the the question stated in the screenshot
    14·1 answer
  • Which type of cell is pictured on the right?
    11·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • on a scale of 1-10, how challenging do you find online learning? What’s going well? What are some of the challenges? What resour
    11·2 answers
  • Which of the following structures help the cell remove wastes:
    14·2 answers
  • DONT POST LINKS
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!