Its called the independent variable I think.
Answer:
1. fragmentation- genetically identical
2. budding- genetically identical
3. haploid cells from two different mycelia fuse to form a zygote- genetically distinct
4. one hyphae creates spores through mitosis- genetically identical
Explanation:
1) Fragmentation is a form of asexual reproduction i.e. one parent, employed by certain organisms including fungi in which a FRAGMENT breaks off from the single parent to produce new cells. Since it is an asexual reproduction, the resulting cells will be GENETICALLY IDENTICAL.
2) Budding is another form of asexual reproduction that fungi undergoes e.g yeast. In the budding process, buds develop on the parent cell and later grow into mature cells that are GENETICALLY IDENTICAL to the parent cell.
3) In fungi, two different mycelia can produce haploid sex cells via the process of meiosis, which then fuse to produce a ZYGOTE. This method is a sexual means of reproduction. Hence, the zygote formed will be GENETICALLY DISTINCT from the parent.
4) Hyphae (threadlike filaments) of a fungi can via MITOTIC DIVISION produce spores, which then germinates under favorable conditions and grows into a new fungus. This new fungus cell is GENETICALLY IDENTICAL to the parent hyphae.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.