1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anyanavicka [17]
3 years ago
7

What is the climate like in South Asia

Biology
1 answer:
yawa3891 [41]3 years ago
8 0
Tropical dry and temperate
You might be interested in
A factor that can change in an experiment is called
zalisa [80]
Its called the independent variable I think. 
7 0
2 years ago
Drag each tile to the correct location. Depending on the type of reproduction, offspring can be genetically identical, a clone o
just olya [345]

Answer:

1. fragmentation- genetically identical

2. budding- genetically identical

3. haploid cells from two different mycelia fuse to form a zygote- genetically distinct

4. one hyphae creates spores through mitosis- genetically identical

Explanation:

1) Fragmentation is a form of asexual reproduction i.e. one parent, employed by certain organisms including fungi in which a FRAGMENT breaks off from the single parent to produce new cells. Since it is an asexual reproduction, the resulting cells will be GENETICALLY IDENTICAL.

2) Budding is another form of asexual reproduction that fungi undergoes e.g yeast. In the budding process, buds develop on the parent cell and later grow into mature cells that are GENETICALLY IDENTICAL to the parent cell.

3) In fungi, two different mycelia can produce haploid sex cells via the process of meiosis, which then fuse to produce a ZYGOTE. This method is a sexual means of reproduction. Hence, the zygote formed will be GENETICALLY DISTINCT from the parent.

4) Hyphae (threadlike filaments) of a fungi can via MITOTIC DIVISION produce spores, which then germinates under favorable conditions and grows into a new fungus. This new fungus cell is GENETICALLY IDENTICAL to the parent hyphae.

6 0
2 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Cultures of a bacterial species were incubated on the shelf of a refrigerator (5 C), out on a lab bench top (22 C), on the shelf
Setler79 [48]

D) Psychrotrophs.

Explanation:

  • Psychrotrophs are those bacteria which can tolerate cold temperature and have optimum growth above 15 degree Celsius.
  • Halophiles prefer high salt concentration.
  • Mesophiles prefer temperatures with a average of 37 degree Celsius.
  • Anaerobes grow in absence of oxygen.
  • In the given experiment, none of the bacterial cultures were placed in saline or anaerobic conditions. So, the bacterial species is not an anaerobe or halophile.
  • Again the cultures did not show growth at 37 degree celsius so they are not mesophiles.
  • Maximum growth at 22 degree celsius and a little growth in refrigerator make it obvious that the species is a Psychrotroph.
8 0
3 years ago
Which of the following types of agriculture is least likely to use genetically modified seeds?
Bogdan [553]

answee

community-supported

8 0
2 years ago
Other questions:
  • When police find a body in a lake or river, they must determine if the person was drowned or was killed in some other way and th
    6·1 answer
  • RNA polymerase possesses its own helicase enzymatic activity. This means that once it binds to a promoter of a gene, it can
    8·1 answer
  • How did Ichthyosaurus survive? Be specific.
    10·1 answer
  • Two questions! please answer ASAP! please give detailed answers.
    14·1 answer
  • Which of the following is not an example of a motor skill?
    10·1 answer
  • The evidence that scientists currently have suggests that life on earth __________.
    12·2 answers
  • Why we used dyes when we prepare onion , human cheek eqithelium smears, and didn’t use it in cork and leaf epidermal cells smear
    5·2 answers
  • James adds some magnetic marbles to a glass jar full of ordinary marbles, and then shakes up the jar. What do you think will hap
    6·1 answer
  • Why is there essentially no waste in the natural world except for waste generated by humans?
    10·1 answer
  • ⚠️Which statement below best describes cell respiration in the mitochondria?⚠️
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!