Answer:
cAMP dependent pathway is important for processing of life.
Explanation:
cAMP pathway is also called as adenynyl cyclase pathway.
This mechanism requires different steps like-
- G protein coupled receptor is a integral protein that is activated by different external stimuli which binds with the specific ligand.
- Extracellular ligand causes activation of GPCR which in turn is responsible for conformational change in the receptor and allows it to bind with the intracellular heterotrimeric G protein complex.
- The Gα stimulate G protein complex to exchange GDP for GTP and then the complex is released.
- Activated Gα binds with adenylate cyclase and catalyzes ATP to form cyclic AMP.
- Activation of cAMP leads to the activation of nucleotide gated ion channel, and PKa(Protein kinase A) which is also called as cAMP dependent enzyme.
- Once, PKA is activated,it causes phospholylation of other proteins like AMPA receptor,transcription factors which regulate gene expression, and convert glycogen into glucose.
Answer:
birth rate and immigration
Explanation:
During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Mutations in gametes (c) can be passed on to future generations. Somatic mutations are not heritable, and neither genes nor alleles are types of cells.
I guess the answer for this would be the DNA but i'm not sure tho, I haven't see this things since a long time.