1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
grandymaker [24]
3 years ago
14

These are the main organs of your excretory system. Which organ is responsible for filtering liquid waste from your blood? A) bl

adder B) kidneys C) ureter D) urethra
Health
2 answers:
Rudiy273 years ago
8 0

These are the main organs of your excretory system. Which organ is responsible for filtering liquid waste from your blood?

B) kidneys

Minchanka [31]3 years ago
6 0
<h2>Answer </h2>

Option B - Kidney

<u>Explanation</u>

The organ of the excretory system which is responsible for the filtration of liquid waste from the blood is kidney. It excretes out excess water and waste products like urea, salts. These waste products are then send to the bladders in the form of urine through ureters. Urine is stored in bladder. It has salts, toxins, and water that need to be filtered out of the blood of the human being.

You might be interested in
Name three ways drug abuse affects mental/emotional health
Rainbow [258]

Answer:

Mental Health Effects. Chronic use of some drugs can lead to both short- and long-term changes in the brain, which can lead to mental health issues including paranoia, depression, anxiety, aggression, hallucinations, and other problems. hope that helps!

5 0
3 years ago
Read 2 more answers
15 POINTS!!!!
Korolek [52]

The types of diseases are mainly classified by their origins. In the International Code of Diseases (ICD)

<h3>The disease with its category</h3>

Cancers disorders of body chemistry - neoplasms

Hormonal disorder of body chemistry - Endocrine, nutritional and metabolic diseases;

Degenerative disease of joints - congenital and hereditary diseases

Degenerative disease affecting the heart - congenital and hereditary diseases

Diseases due to physical and environmental agents -Injury, poisoning and some other consequences of external causes;

Degenerative disease of the brain - congenital and hereditary diseases

Mental diseases - congenital and hereditary diseases

With this information, we can conclude that the types of diseases are classified mainly by their origins. In the International Code of Diseases (ICD)

Learn more about ICD in brainly.com/question/26042268

8 0
3 years ago
What is a common myth about illegal drugs?
Hatshy [7]
D it takes time to develop to them
8 0
3 years ago
Read 2 more answers
My deuznuts = dezunuts
leonid [27]

sheeeeeeesh ur spittin some real facts here

6 0
3 years ago
How your day going How do you define health?
Darya [45]

Answer:

Health is a state of complete physical, mental and social well-being and not merely the absence of disease or infirmity

5 0
3 years ago
Read 2 more answers
Other questions:
  • Que metas te gustaria cumplir durante este tiempo en casa?
    14·1 answer
  • Changes in eating habits can be a physical sign of addiction. true or false
    8·2 answers
  • What system is going to deliver the nutrients broken down by the digestive system to other organs ,tissue , and cells in the bod
    8·1 answer
  • Whats the relationship beetwen diet and ostheoporosis
    15·1 answer
  • An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
    12·1 answer
  • Is important to cancer patients
    13·1 answer
  • Why is understanding the risks and hazards associated with fires important?
    6·1 answer
  • True or False: Foods that are high in fiber can help remove unhealthy cholesterol and support a healthy digestive track.
    10·2 answers
  • EXPLAIN <br> ======================
    10·1 answer
  • How are carbohydrates "protein sparing"
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!