1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yuradex [85]
2 years ago
9

Which of the following are functions of stems in a typical plant? Choose three correct answers.

Biology
1 answer:
Mashcka [7]2 years ago
8 0
A. Hold leaves up to the sun
C. Gather water and nutrients from the soil
E. Transport water and nutrients
You might be interested in
A plant breeder wants to breed a flowering plant species to produce seeds that will give a 50:50 mixture of blue and yellow flow
Dennis_Churaev [7]
Answer- you would use a Punnet Square to cross the kinds. In order to know which ones to use, you'd have to test them all. Without knowing what each letter codes for it is hard to show
5 0
3 years ago
Water is a ____ molecule
rusak2 [61]
Water is a H2o molecule
6 0
3 years ago
5. In the following picture, label each of the letters<br> with what is occuring
sp2606 [1]

Answer: see explanation

Explanation:

A. substrate

B. Active site

C. Enzyme binds with substrate

D. Active site of enzyme

E. Products leaving active site

Simplified enzymatic reaction. The substrate reversibly binds to the active site of the enzyme, forming the enzyme-substrate (ES) complex. The bound substrate is converted to product by catalytic groups in the active site, forming the enzyme-product complex (EP). The bound products are released, returning the enzyme to its unbound form, ready to catalyze another round of converting substrate to product.

7 0
2 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
A client who is having presurgical testing before a colon resection and possible colostomy says to the nurse, "if i have to have
evablogger [386]
<span>You seem worried that the surgery will change how others see you" is an open-ended response that encourages further discussion. The response "You seem concerned that your partner will reject you" is too specific; the nurse does not have enough information to come to this conclusion. The response "You are wondering about the effect on your sexual relations" is too specific; the nurse does not have enough information to come to this conclusion. The response "You are probably underestimating your partner's love for you" denies the client's concern and may cause feelings of guilt for questioning the partner's love.</span>
5 0
3 years ago
Other questions:
  • Which assisted reproductive technology process involves the fertilization of a woman's egg outside of her body and the transfer
    9·1 answer
  • IF<br> 21 - 4<br> 13 = 6<br> 23 = 12<br> 34 = 24<br> THEN<br> 25 = ?
    12·1 answer
  • Which of the following is/are important features of a weight system? The ability to quickly and reliably jettison at least enoug
    10·1 answer
  • _______________________________ are plants that produce flowers, and include grasses, roses, and maple trees.
    15·1 answer
  • How much force is needed​ to lift a 25 kg mass?
    8·1 answer
  • Germination A. is the same process for both monocots and dicots. B. ends with dormancy. C. is the process that occurs when the s
    7·1 answer
  • Mark is participating in one of Posner's attention experiments. As he looks at the fixation point, an arrow pointing to the righ
    14·1 answer
  • Can someone please double-check these for me​
    11·1 answer
  • What is noise pollution?
    8·2 answers
  • The primary vectors used in gene therapy are:a. fungib. virusesc. bacteriad. mosquitose. prescription drugs
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!