1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fgiga [73]
3 years ago
14

What effect does gravity have on stars?​

Biology
1 answer:
natulia [17]3 years ago
3 0

Answer:

The gravitational pull of the moon pulls the seas towards it, causing the ocean tides. Gravity creates stars and planets by pulling together the material from which they are made. Gravity not only pulls on mass but also on light.

Explanation:

You might be interested in
What are two examples of nuclei acids?
cricket20 [7]

Answer:

dna

and

rna

are the two types

4 0
4 years ago
Read 2 more answers
IMPORTANT!1! DUE TOMORROW
kondor19780726 [428]

                                                                       

                                                                                                                                                        .................................................................

5 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Can someone help me with this, please? <br><br> What are the eight major mineral groups?
Contact [7]

Answer:

calcium, iron, magnesium, potassium, chloride, zinc, sodium, sulfur

Explanation:

4 0
3 years ago
Which is true about the tides? A. High tide is when the ocean water level is the lowest. B. Between high tides, there is a low t
Hoochie [10]

Answer:

I believe the answer is B.

Explanation:

It's not A, C and I don't think it's D.

As the Earth rotates, your region of Earth passes through both of these bulges each day. <u>When you're in one of the bulges, you experience a high tide. When you're not in one of the bulges, you experience a low tide.</u> This cycle of two high tides and two low tides occurs most days on most of the coastlines of the world.

7 0
4 years ago
Read 2 more answers
Other questions:
  • Why do enzymes lose their function when they are subjected to extreme temperature changes?
    6·1 answer
  • How do wild horses keep their hooves short?
    9·1 answer
  • What characteristics apply to all species in kingdom protista?
    9·1 answer
  • Which of the following are the reproductive parts of an angiosperm flower? A. anther and ovary B. sepal and anther C. vary and s
    9·1 answer
  • In humans and other multicelluar organisms, whic substance plays a central role as an energy source?
    10·1 answer
  • Boris Magasanik collected data on the proportion of each base in RNA from different species. To compare the relative amount of e
    11·1 answer
  • In Linnaeus's time, all living things were grouped into two kingdoms. Later, there were five kingdoms, and know we have six king
    5·2 answers
  • Salt is used to melt snow and keep roads clear during the winter in many cities. Land adjacent to de-iced roads often ends up wi
    5·1 answer
  • What does ordered internal structure mean
    13·2 answers
  • What is the term used when solute moves across a semipermeable membrane
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!