1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Umnica [9.8K]
4 years ago
9

What are the pros and cons of genetically modified foods​

Biology
2 answers:
STatiana [176]4 years ago
6 0
Pros:
more food is produced in mass amounts
is cheaper than non gmo food
easier and more efficient access
cons:
not as healthy/may contain chemicals
is more expensive
hard to access sometimes because is usually at fresh or local markets
ss7ja [257]4 years ago
5 0

Answer:

MARK the person above as brainliest

You might be interested in
Oil is most likely to form becauseChoose one:
Luden [163]

B. tiny algae and plankton decomposed under conditions of heat, pressure, and low oxygen.

Explanation:

Oil is most likely to form where tiny algae and plankton decomposed under conditions of heat, pressure and low oxygen.

  Coal will form when plant materials like twigs, leaves and tree trunks decomposed under conditions of heat, pressure and low oxygen.

  • To form oil, algae and plankton will be gathered with sediments in a basin.
  • Rapid burial causes the algae and plankton to be cut off from aerobic environment that would lead to the decay of these organisms.
  • They are buried alive and as the basin subsides, temperature and pressure acts to produce kerogen.
  • Further cracking produces oil and gas.

Learn more:

Fossil fuel brainly.com/question/9231468

#learnwithBrainly

3 0
4 years ago
Sonya has a chronic illness, and to treat the condition, she takes an antibiotic every day. despite her illness, sonya's diet is
mylen [45]

Sonya has a chronic illness, and to treat the condition, she takes an antibiotic every day. Despite her illness, Sonya’s diet is nutritionally adequate, and she exercises regularly. Based on this information, Sonya may need to <span>take a dietary supplement that contains vitamin K.</span>

8 0
3 years ago
The net effect of the effector is to shut off the original ________, or reduce its intensity, during the negative feedback mecha
Karo-lina-s [1.5K]

Answer:

option D

Explanation:

Negative feedback is a mechanism in which function of a cell or an organ is decreased. It lessened the output of a system and maintain system function which is known as homeostasis. It is a regulatory mechanism of normal physiology. Some of examples are

blood sugar level regulation, regulation of blood pressure, thermoregulation and many more.

5 0
3 years ago
The species that is known as a robin in England has a yellow breast, and another species that is known as a robin in the United
Fittoniya [83]

Answer:

The correct option is <em>C. Different species can share the same common name.</em>

Explanation:

A single organism might have the many common names or it might happen that different species have the same common name in different parts of the world. Common names can be sued when people from the same country, speaking the same language are talking.

But as scientific research is carried out in all parts of the world, scientists made up the system of binomial nomenclature. Under this system, each specie is given a unique name .

3 0
4 years ago
Read 2 more answers
By computing the present value of the principal paid at maturity and all interest payments to be made over the term of the bond,
solong [7]
By computing the present value of the principal paid at maturity and all interest payments to be made over the term of the bond, you can obtain the market price of bonds. Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions here.
3 0
3 years ago
Read 2 more answers
Other questions:
  • For this question, we will utilize a population of Martians that is in Hardy Weinberg Equilibrium. The dominant Martian phenotyp
    13·1 answer
  • What are the main functions of the skeletal system?
    13·1 answer
  • Which of the following answer choices is not a valid type of mrna editing that occurs during the process of transcription?
    6·1 answer
  • Which of these is a way the immune system works with other body systems?
    5·2 answers
  • a person with type O blood is often called the universal donor why might this be a good time to use to describe such a person
    7·1 answer
  • Can you guys please help me I have a test tomorrow
    11·1 answer
  • Please help, 100 points! Most scientists agree that life began on earth approximately 3.5 billion years ago. What would a scient
    11·2 answers
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • Explain in short about the importance of herbs​
    7·1 answer
  • Suggest why glucose is converted to glycogen rather than kept as glucose inside the cells
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!