1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexandra [31]
3 years ago
13

Scientific _______ are logical conclusions that are drawn from scientific observations.

Biology
2 answers:
Usimov [2.4K]3 years ago
6 0
Scientific INFERENCES are logical conclusions that are drawn from scientific observations. :-)
Scilla [17]3 years ago
6 0

Answer:

Interference

Explanation:

An inference refers to the deduction of a reasonable conclusion from an experiment. An inference is drawn based on a logical hypothesis  

Let’s take an example – The following two cases represent the hypothesis  

Case 1 – Water enhances the growth of pea plant

Case 2 - Water do not enhances the growth of pea plant

Experiment – Two  pea plant is allowed to grow as follows –

a) One with normal water  application  

b) The other one with increased water quantity

Rest all factors like sunlight, air etc are kept constant.  

In such scenario, if it is observed that pea plants receiving higher water quantity will attain more height as compared to the one  receiving normal water quantity, then it can be inferred that "height of pea plant increases with the increase of water "

Such an inference is called “inference based on observation”

You might be interested in
Ehrlich and Raven hypothesized that if a new defensive trait evolves in a single plant species (or if a new trait to counteract
Blababa [14]

Answer:

Coevolution

Explanation:

Ehrlich and Raven observed butterfly species and their host plants. Plant species had adopted a series of defence mechanisms against butterflies. In response the butterflies also evolved new traits to avoid these defence mechanisms.

In this way both butterflies and plants influenced each other's traits and they co evolved. The coevolution can lead to accumulation of lot of different characteristics which can lead to formation of new species and species diversification. Formation of new species will be observed both in plants and butterflies.

7 0
3 years ago
Determine tRNA anticodons<br> UACCUGUUAAGCUACAAAAUU
Pavel [41]

Answer:

i dont know sorry , Gooqle it

7 0
3 years ago
As fast as you can, name the planets in order from the sun.
Oksi-84 [34.3K]

Answer:

Mercury, Venus, Earth, Mars, Jupiter, Saturn, Uranus, Neptune

Explanation:

Thenks and mark me brainliest :))

6 0
3 years ago
Read 2 more answers
After the big bang, atoms in gas clouds experienced a greater gravitational pull to each other than atoms in other regions of th
Anettt [7]

e.when the mass of an object increases, its gravitational pull also increases


4 0
3 years ago
Read 2 more answers
Tigers and lions inhabit different areas and different habitats. Tigers live in forested areas in South East Asia while Lions in
Phantasy [73]

Answer:

A. In biology, species can be described as organisms which are similar and are able to inter breed and produce fertile offsprings. According to the definition, tigers and lions have the capability to interbreed and produce viable offsprings. Hence, they can be classified as same species.

B. In ecological terms, I will not classify lions and tigers as the same species. Because they are not living in the same areas and belong to different environments.

8 0
4 years ago
Other questions:
  • The fibrous skeleton of the heart functions in all of these ways except in __________.
    13·1 answer
  • A 9-year-old child who has cerebral palsy and scoliosis also is mentally challenged and blind. the child is incontinent, has con
    9·1 answer
  • Type of very specific antibodies produced from a population of identical cells
    14·1 answer
  • Horseshoe crabs are one of the only five living species of arthropods class
    5·2 answers
  • Which conditions are low air pressure system usually associated with
    11·2 answers
  • _____ refers to the activation, often unconsciously, of certain associations, thus predisposing one's perception, memory, or res
    12·1 answer
  • In many cities, wastewater travels through sewer lines to be processed at a
    11·1 answer
  • What is the application of Gene Editing in Primary T Cells?
    7·1 answer
  • What are the three main functions of the cardiovascular system?.
    5·1 answer
  • Explain why it may have been difficult to discover pond water organisms from pond water sample under the microscope comparing to
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!