1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viefleur [7K]
3 years ago
10

Determine tRNA anticodons UACCUGUUAAGCUACAAAAUU

Biology
1 answer:
Pavel [41]3 years ago
7 0

Answer:

i dont know sorry , Gooqle it

You might be interested in
Which statement accurately describes the Doppler effect?
AfilCa [17]

Answer:

It indicates galaxy motion through light wavelengths. It indicates a galaxy moving toward Earth through red shift.

Explanation:

3 0
3 years ago
Read 2 more answers
I need this for a test.
Bond [772]

Answer:

the water soaks up a huge amount of heat thereby regulating temperature, it also helps with cold mitigation as it will release of lot of heat energy

Explanation:

4 0
3 years ago
The molecule that brings amino acids to the ribosomes to be assembled into proteins is
SIZIF [17.4K]

tRNA brings amino acid molecules to the ribosomes during protein synthesis

4 0
3 years ago
Read 2 more answers
Semen contains all of the following, EXCEPT
kap26 [50]

Answer: C. Clotting enzyme

Explanation:

Semen is the fluid that is discharged by the male reproductive organs. It is composed of sperms and viscous fluid to facilitate the flow of sperms to the female genital tract. It consists of fluids secreted from various glands. The seminal vesicles secrete about 70% of the semen. It consists of fructose. The prostrate gland secrete about 20% volume of the semen. The fluid consists of acid phosphatase, and proteolytic enzymes. The bulbourethral gland secretes about 5% of the total volume of semen. It consists of mucoproteins.

The clotting factors or enzymes are absent in semen as these are produced by the blood platelets at the site of injury.

8 0
4 years ago
What is needed for translation to occur? Check all that apply.
Anastasy [175]

the answer is A just took the quiz


4 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following best describes the total amount of carbon in the system made up of the Earth and its atmosphere?
    14·1 answer
  • A frog in the example of _______?
    15·1 answer
  • How long and how frequently should cold be applied to the injured area during the first 24 to 48 hours?
    7·1 answer
  • which is a valve between the right atrium and the right ventricle of the heart that directs blood that needs oxygen to the lungs
    7·1 answer
  • What is morphological computation? on how the body contributes to cognition and control?
    8·1 answer
  • Which type of fossil contains little or no organic material
    11·1 answer
  • Which sequence is listed in order from simplest to most complex
    12·1 answer
  • The so called "blue" (really gray) Andalusian variety of chicken is produced by a cross between black and white varieties. Only
    9·1 answer
  • Meiosis ii typically produces _____ cells, each of which is _____.
    10·1 answer
  • 100 points hurry
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!