1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viefleur [7K]
3 years ago
10

Determine tRNA anticodons UACCUGUUAAGCUACAAAAUU

Biology
1 answer:
Pavel [41]3 years ago
7 0

Answer:

i dont know sorry , Gooqle it

You might be interested in
15. A mountain divides a population. After many years the organisms show genetic differences from the original
Papessa [141]

Answer:

A

Explanation:

Divergent Evolution occurs when a group of animals emigrates into a new area that is separated by a geographic barrier such as a mountain.

8 0
2 years ago
What kind cell has chromosomes like this
igomit [66]
Chromosomes are thread-like structures located inside the nucleus of animal and plant cells. Each chromosome is made of protein and a single molecule of deoxyribonucleic acid (DNA<span>). Passed from parents to offspring, </span>DNA<span> contains the specific instructions that make each type of living creature unique.</span>
8 0
3 years ago
Twoi or more atoms can be held together through schared
Levart [38]
Your answer would be valence electrons, i believe.
3 0
3 years ago
Pls answer i need answer now
Pepsi [2]
It’s blurry I can’t see it good
7 0
3 years ago
What are some examples of adaptations that animals have for improving their chances of reproduction and offspring survival?
m_a_m_a [10]

Answer:

1. Claws 2. Hibernation 3. Venom

Explanation:

4 0
3 years ago
Other questions:
  • Why are leaves green and in what cell organelle is it stored
    15·2 answers
  • How does monitoring environmental parameters affect policies regarding resource use?
    10·1 answer
  • While assessing an older adult during a regular health checkup, a nurse finds signs of elder abuse. which physical findings woul
    15·1 answer
  • Which air mass often originates as a different air mass in Siberia and is subsequently altered?
    14·2 answers
  • Contrast the location of genetic material in bacterial cells to its location in plant and animal cells
    8·1 answer
  • The flu vaccine activates adaptive immunity. How does this occur? The immune system identifies antigens on the weakened flu viru
    6·2 answers
  • Where in the cell does transcription occur
    7·2 answers
  • What is a cell that is the source of other cells
    12·2 answers
  • After throwing a basketball through the net, Anna observed the ball as it hit the
    15·2 answers
  • Can two normal parents have a hemophiliac child? Work out the probability.!.!.!
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!