1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viefleur [7K]
3 years ago
10

Determine tRNA anticodons UACCUGUUAAGCUACAAAAUU

Biology
1 answer:
Pavel [41]3 years ago
7 0

Answer:

i dont know sorry , Gooqle it

You might be interested in
Any substance designated under the clean water act and the comprehensive environmental response, compensation, and liability act
Sav [38]
Answer:  "hazardous substance" .
_____________________________________________________
5 0
3 years ago
​the concentration of proteins synthesized in the breast is more affected by the _____.
noname [10]
The correct question for this is: "<span>The concentration of proteins synthesized in the breast are more affected by _____ than _____."

The correct answers are the age of the infant and maternal intake and maternal serum proteins. 

While maternal intake and serum proteins contribute to the proteins synthesized in the breast tissue, the age of the infant will affect the composition of the breast milk as he or she ages. This is because of the reason that the demand for nutrients of the infant should be fulfilled until the recommended breastfeeding age of 2 years old.</span>
4 0
4 years ago
WILL GIVE BRAINLIEST ANSWER AND THANK YOU!!!
zzz [600]
Incomplete please thank and mark brainliest

7 0
4 years ago
What are elements found in proteins
sweet-ann [11.9K]

Answer:

Carbon Hydrogen Oxygen and Nitrogen.

Explanation:

Have you heard about Cho Cho Chon Chonp?

6 0
3 years ago
Read 2 more answers
On a trip to the beach, Jacob noticed many signs that read "Keep off dunes." His mother told him that walking or digging on the
yawa3891 [41]

Answer:

Almost any human interaction. One main cause: Construction.

Explanation:

To build anything, the construction area must first be cleared. In the case of a pier being built, the dunes would have to be disrupted in order to burrow down to bedrock to provide adequate support for the pier.

5 0
3 years ago
Other questions:
  • The body is composed of microscopic cells that are visible if viewed under a ____
    8·2 answers
  • Most animals make energy available
    8·2 answers
  • What is the island of Hispanola named today?
    15·1 answer
  • In this biome, very little light reaches the ground, because the tops of trees form a thick, dense canopy. Therefore, many plant
    10·1 answer
  • Based on the karyotype above, which of the following best describes the production of gametes in human females? At the end of th
    14·1 answer
  • ________________ translates code on DNA and carries it from nucleus to cytoplasm to be read. hhhhhhhhhhhhhhhhhhhhhhheeeeeeeeeeee
    12·1 answer
  • Which is an example of heterozygous genotype?<br> [A] AA<br><br> [B] Aa<br><br> [C] aa
    15·2 answers
  • What statement describes a disruption that would decrease the amount of atmospheric carbon?
    15·1 answer
  • How can communities limit earthquake damage?
    15·1 answer
  • What category of gymnosperms is pollinated by the snout beetle?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!