1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viefleur [7K]
2 years ago
10

Determine tRNA anticodons UACCUGUUAAGCUACAAAAUU

Biology
1 answer:
Pavel [41]2 years ago
7 0

Answer:

i dont know sorry , Gooqle it

You might be interested in
Which will most likely cause an increase in the frequency of genetic mutations in humans?.
Alex Ar [27]
Increased exposure to X-rays
8 0
2 years ago
How are ethanol and glucose similar in structure and function?
maria [59]
It is A , d , and c . I can bet my last bagel bite
6 0
2 years ago
WHAT ARE THE DIFFERENCES BETWEEN TEMPORARY AND PERMANENT CHANGE
Masteriza [31]
The difference between temporary and permanent is temporary will only last a little while, permanent on the other hand lasts forever
7 0
2 years ago
Read 2 more answers
During the rock cycle, rocks get broken apart by weathering, carried along by erosion, and eventually deposited in a body of wat
vagabundo [1.1K]
After many years of pressure and possibly heat it will be compressed back into a form of rock such as sediment.
8 0
2 years ago
Read 2 more answers
What icon is usually used to indicate an attachment feature?
LuckyWell [14K]

An icon is a symbolic representation of an action to be taken, given in emails or message bars. Icons are metaphorical representations of emotions and feelings which a human is unable to explain in words.

The icon used to represent an attachment is paper clip.

When we click this paper clip icon, it allows us to attach any file including a document or a picture in that particular email. An attachment may also contain a virus, Trojans, worms and other form of malware.

 


6 0
3 years ago
Read 2 more answers
Other questions:
  • Which statement represents a characteristic of
    8·1 answer
  • Which process(es) increases genetic diversity in a population?
    9·1 answer
  • Metabolic regulation
    7·1 answer
  • What are positive and negative results from genetic engineering in humans?
    12·2 answers
  • He reflexes from sense organs in the head are co-ordinated by the brain.
    13·1 answer
  • ----- are fracture in the earths crust where rocks move and slide past other
    7·1 answer
  • What do chains of amino acids makes
    6·2 answers
  • In order to perceive forms and patterns from incoming stimuli, individuals utilize____.
    7·2 answers
  • many promoters of a hypothetical conserved gene have mostly adenines and thymines. what is the most likely reason for this high
    11·1 answer
  • For you who who like brainly
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!