1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viefleur [7K]
2 years ago
10

Determine tRNA anticodons UACCUGUUAAGCUACAAAAUU

Biology
1 answer:
Pavel [41]2 years ago
7 0

Answer:

i dont know sorry , Gooqle it

You might be interested in
All arthropods have similar nervous systems. What are the components of an arthropod's nervous system?
rodikova [14]
The answer regarding the components of an arthropod's nervous system would be item C. It consists of brain, nerve chord, and ganglia. The brain is located dorsally, while the nerve cord together with the ganglia is ventrally structured — extending on each segment of an arthropod’s body.
4 0
3 years ago
At the cellular level, cells produce carbon dioxide in the process of cellular respiration.
julsineya [31]
C there your answer i hope it help
4 0
3 years ago
What is a membrane lipids?
Yuri [45]
A membrane lipid is a compound which belongs to a group of (structurally similar to fats and oils) which form the double-layered surface of all cells (lipid bilayer). The three major classes of membrane lipids are phospholipids, glycolipids, and cholesterol.
4 0
3 years ago
Read 2 more answers
How do the functions of the skeletal and muscle system differ?
jasenka [17]

The skeletal system supports and protects the body and the muscular system is for movement.

8 0
3 years ago
Why is science your favorite subject?
adoni [48]
Because science is always changing and every time you cam come up with a new outcome.
7 0
3 years ago
Other questions:
  • Summarize theories of how living organisms came to exist....
    7·1 answer
  • What is the brain made of
    14·1 answer
  • Contamination of food items by other living organisms is known as:
    7·2 answers
  • What is the nuclear charge of this ion?
    15·1 answer
  • Which feature of model 1 best illustrates how biological information is coded in a DNA molecule?
    9·1 answer
  • What was the Industrial RevoWhich is a consumer? A. algae B. human C. cabbage D. carnationlution?
    13·1 answer
  • The following is a list of events involved in the activation of a cell by a steroid hormone. Which one of the following answers
    8·1 answer
  • What is one of the causes of mechanical weathering?
    13·2 answers
  • A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the
    10·1 answer
  • Mitosis cell division are required to form 64 cell for one cell?<br>a.4<br>b.6<br>c.16<br>d.32<br>​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!