1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fittoniya [83]
3 years ago
9

the branch of biology dealing with interactions among organisms and between organisms and their environment is called

Biology
1 answer:
anygoal [31]3 years ago
7 0
The branch of biology dealing with interactions along organisms and between organisms and their environment is called Ecology, I believe.
You might be interested in
Organisms that eat both producers and consumers are called ____ than stars.
Contact [7]
Organisms that eat producers and consumers are called omnivores.
6 0
3 years ago
________ is the involuntary expulsion of the contents of the stomach and duodenum out the mouth
wlad13 [49]

Answer:

<h2><u>Vomiting</u></h2>

Explanation:

<em><u>Vomiting</u></em> is the involuntary expulsion of the contents of the stomach and duodenum out the mouth

Hope this help

plz mark brainliest

Have a nice day!!!!

7 0
3 years ago
Forms of the Ras protein found in tumors usually cause which of the following events to occur? excessive cell division decreased
Bas_tet [7]

The Ras protein found in tumors usually cause which of the following events to occur excessive cell division.

<h3>How does Ras oncogene contribute to cancer?</h3>

Ras genes codes for proteins that can drive cancer when mutated.

All Ras proteins are GTPases which work as molecular regulators in the cell, controlling signaling pathways and other interactions.

Thus, option "A" is correct.

To learn more about Ras protein click here:

brainly.com/question/14994384

#SPJ1

4 0
2 years ago
Of the uterus.
velikii [3]
Follicle is your answer
6 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • A population of 20 monarch butterflies colonizes a meadow. The meadow's carrying capacity for monarch butterflies is 5,000 indiv
    8·2 answers
  • Which shows the levels or organizational hierarchy listed from least complex to most complex
    5·1 answer
  • Is a prosthetic group present in several components of the electron transport chain?
    11·1 answer
  • Select all that apply. Chromosomes _____.
    13·2 answers
  • HELP ASAPPPP PLZZZ
    14·1 answer
  • In an experiment to test a new drug’s effectiveness, one group is given a larger dosage than is typically prescribed, and a seco
    14·2 answers
  • Head lice, small insects, are found on two elementary school students. As these two students
    8·2 answers
  • Why does the note A-natural sound different on a tuning fork, a violin, and a flute?
    13·1 answer
  • What are the results of desertification
    14·1 answer
  • True or false all cells have the same structure and funcition
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!