1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OLga [1]
3 years ago
15

What is the green colored body in plants cells

Biology
1 answer:
andrew-mc [135]3 years ago
7 0
that is called chlorophyll it keeps the plants green
You might be interested in
A water well is a structure created to obtain water from deep in the geosphere. Where is the well obtaining this water?
Darina [25.2K]
Usually under ground springs, or sometimes hollowed earth beneath solid earth where the water pools.
6 0
3 years ago
Read 2 more answers
An epithelial cell with Celia would have them on the ______ surface.
JulijaS [17]

Answer: C) Apical

Explanation: An epithelium has a free surface, the apical surface, exposed to the outside, and an attached surface, the basal surface, resting on the underlying connective tissue.

6 0
2 years ago
At which stage is glucose broken into smaller molecules? A. before cellular respiration begins B. during the first stage of cell
Vesnalui [34]

b. the first stage because it could never be in the secound stage

8 0
3 years ago
Read 2 more answers
The people who put together the factors of production to produce goods is called
Sliva [168]

Answer:

an entrepreneur or innovater

5 0
3 years ago
Chain of amino acids is an example of a:<br> A)protein<br> B)carbohydrate<br> C)lipid<br> D)sugar
krek1111 [17]
A) Protein chain of amino acids
7 0
3 years ago
Other questions:
  • Is/are used in chronic pain management, to treat attention deficit hyperactivity disorder, and as a treatment for bedwetting. be
    6·2 answers
  • Jayden has been given 5 cubic centimeters each of 4 unknown samples of gaseous substance. He has been asked to identity which on
    14·1 answer
  • Why do we need carrier proteins for steroid hormones?
    10·1 answer
  • Why is circular doubled stranded DNA the preferred
    14·1 answer
  • HELP FAST !! 20 p. When matter evaporates or boils, both processes end up with the same result.
    11·1 answer
  • Which sentence about protists is accurate
    11·1 answer
  • Which of these is a segment of DNA that contains the information necessary to produce a protein? A) a base B) a gene C) a codon
    8·2 answers
  • BRAINLIEST
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What that determines if a cell is eukaryotic. *
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!