1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iris [78.8K]
3 years ago
15

Which of the following statements about the dark reactions is true? a. Dark reactions occur in the thylakoids of chloroplasts. b

. Light energy is converted to chemical energy during the dark reactions. c. Carbon dioxide is converted to sugar using ATP and NADPH during the dark reactions. d. All of the aboveWhich of the following statements about the dark reactions is true? a. Dark reactions occur in the thylakoids of chloroplasts. b. Light energy is converted to chemical energy during the dark reactions. c. Carbon dioxide is converted to sugar using ATP and NADPH during the dark reactions. d. All of the above
Biology
2 answers:
algol133 years ago
8 0
The correct answer is C !! Carbon dioxide is converted to sugar using ATP and NADPH (formed in light reaction) during dark reaction !! It is also called Calvin Cycle !!

Go with C !!
umka2103 [35]3 years ago
5 0

Answer: The correct answer is -

Option C).

Explanation:

Dark reaction (also termed as calvin cycle) is the second stage of the photosynthesis (process of formation of food in green plants and algae) that occurs in the stroma of chloroplast.

This stage is dependent on the products of light reaction (first stage of photosynthesis) that are NADPH and ATP.

Using these products, CO2 (carbon dioxide) is fixed and converted into food (glucose, which is a carbohydrate or sugar).

Thus, option C) is the right answer.

You might be interested in
Reproduction is one of the characteristics of life. Which of the following choices is an example of reproduction?
snow_tiger [21]

Answer:

C, bacterial cells dividing

Explanation:

because these are simple, one celled organism, they don't reproduce with male and female, instead they go through mitosis which is when a cell divides into two to reproduce. while A does include this, since skin belongs to a bigger organism it doesn't count as reproduction. B talks about development/growth, and D talks about something completely different to reproduction. hope it helped

3 0
3 years ago
All plant and animal groups existing together and the physical factors with which they interact compose a(n)
dexar [7]

Ecosystem. it is defined as a biological community of interacting organism and their physical environment.

4 0
4 years ago
Learning Task No. 2: Copy and complete each statement. Choose from the
Lunna [17]

Answer:

1. Aorta

2. Left atrium

3. Right ventricle

4. The pulmonary artery

5. Left ventricle.

Explanation:

The aorta is the main artery of the body that carries the oxygen-rich blood to all the body parts except the lungs from the left ventricle. It is divided into main coronary arteries or blood vessels.

The left atrium is one of the heart chambers, it is located in the upper part of the heart on the right side that receives the oxygenated blood from the lungs through the pulmonary vein.

The right ventricle is the chamber of the heart that pumps the deoxygenated blood to the pulmonary valve to MPA to the lungs to get oxygenated.

The pulmonary artery or the main PA (MPA) carries the oxygen-depleted blood from the right ventricle into the lungs, where blood becomes oxygenated.

The Left ventricle is the thickest muscle chamber of the heart responsible for the pumping oxygen-rich blood to the circulatory system and to the body through the aorta.

8 0
3 years ago
How are destructive forces related to two spheres of the Earth System
ElenaW [278]
Cause it just connects
7 0
4 years ago
What two stages are involved in the energy generation process
Luba_88 [7]
Respiration is one of them

8 0
3 years ago
Other questions:
  • Exercise is needed to keep muscles
    11·2 answers
  • If a plant has a high concentration of minerals inside its root cells, but does not have enough energy for active transport, wha
    11·1 answer
  • ______________is the passing of a wave through an object.
    10·2 answers
  • Which is not a characteristic of life<br>Evolve <br>Cells<br>DNA<br>Oxygen ​
    10·1 answer
  • scientists on mars have been investigating the genetic makeup of organisms in this community. use the information provided and y
    11·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • What proportion of people who are infected with polio develop neurological problems?
    9·1 answer
  • Which of the following statements regarding genetic diversity is false?
    6·1 answer
  • What is the primary role of photosynthesis in the carbon cycle?
    6·1 answer
  • The virtually universal decline in near vision in middle adulthood is called __________.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!