Answer: In some organisms, chloroplasts play a vital role in the photosynthesis process. The chloroplast receives sunlight's energy and converts it to sugars. In some organisms, chloroplasts play a vital role in the photosynthesis process.
Explanation:
<h2>Receptors for hearing are in the cochlea; receptors for balance are in the vestibule.</h2>
Hope this will help....
Answer:
b. Vernalization
Explanation:
Vernalization is a phenomenon in which plants require low temperature for the flowering. There is either qualitatively or quantitatively dependent on exposure to very low temperature. This process is known as vernalization. Vernalization defines especially to the promotion of flowering by a period of low climate. For example; Vernalisation occurs in biennial plants. Biennials are monocarpic plants which normally flower and may die in the second season. Some common examples of biennials are carrots, Sugarbeet, cabbages, etc.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
9. It is a warm summer night, 32oC, with the relative humidity at 100%. During the night, the air temperature drops to 18oC. You would expect to see___on the ground in the morning.
A) dew
10. Scientists believe that during the Late Cretaceous period, many small seas dried up and new mountains began to rise. Which would MOST LIKELY cause them to believe the temperature decreased during this time?
A) The absence of fossils of warm-weather plants.
11) A hurricane is MOST LIKLEY to occur in an area
A) near warm water.
12) A team of archaeologists excavating a sedimentary rock layer come across some primitive hunting tools used by early humans. As the dig progresses, they unearth the fossilized remains of a dinosaur from another layer of the sedimentary rock. Why do these discoveries indicate that the rocks were formed over millions of years?
C) Dinosaurs became extinct millions of years before humans appeared.
Hope I helped!
