1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jekas [21]
3 years ago
12

Why is nitrogen so special

Biology
2 answers:
mojhsa [17]3 years ago
7 0
It makes up protein and nucleic acids, that comprise the hereditary
Cerrena [4.2K]3 years ago
5 0
Because it's the most abundant gas in atmosphere , required by plants
You might be interested in
How is transformation in bacteria most accurately described? assimilation of external dna into a cell the creation of a strand o
erma4kov [3.2K]
The definition of transformation in bacteria is described by the first statement: transformation is the assimilation of external dna into the bacterial cell. In a more elaborate sense, transformation is described by the altering of the cell as a result of the uptake or intentional incorporation of dna from an external source. It is one of the three processes for horizontal gene transfer. The other two are transduction (infection of a phage), and conjugation (transfer of dna between two bacterial cells that are directly in contact). 
8 0
4 years ago
NEED ANSWER FAST PLEASE!!!! Which professions require licenses to practice? only cosmetologists and dermatology technicians only
exis [7]

Answer: Dermatologists, dermatology technicians, and cosmetologists

Explanation:

4 0
3 years ago
How do pesticides affect the environment
klio [65]
Pesticides<span> can travel great distances through the </span>environment. When sprayed on crops or in gardens,pesticides<span> can be blown by the wind to other areas. They can also flow with rain water into nearby streams or can seep through the soil into ground water. ... Selective </span>pesticides<span> are toxic only to the target pests.</span>
3 0
3 years ago
Write in short about connecting links and embryonic evidence.​
Drupady [299]

Explanation:

hope this will help u.

Give brainliest

7 0
3 years ago
This organelle carries
Angelina_Jolie [31]

I believe that is the nucleus, if so the answer is D) Genetic Information. The nucleus carries chromosomes that are composed of DNA that carry genetic information.

7 0
4 years ago
Read 2 more answers
Other questions:
  • Arthropods have an exoskeleton which they shed as they grow. What is this process called?
    9·2 answers
  • What theory suggests that our body's dna genetic code contains a built-in time limit for the reproduction of human cells?
    12·1 answer
  • NEED HELP!!
    14·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • The nursing instructor is preparing an illustration which will point out the various functions of the placenta during the pregna
    12·1 answer
  • Which planet has a surface that is almost entirely covered in liquid water? A. Mars B. Earth C. Mercury D. Venus
    6·2 answers
  • Wolves live and hunt together in a group called a pack. Typically, there is a leader called an alpha male or alpha female, but e
    15·1 answer
  • The response of an effector is:
    8·1 answer
  • Which statement correctly describes the difference between cellular respiration and photosynthesis?
    5·2 answers
  • 4a. By 40-60 years after farm fields had been abandoned, the amount of herbaceous plants
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!