1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sashaice [31]
3 years ago
11

Sally's brother is color-blinded. her husband is normal. what is the chance for her son to be color-blinded?

Biology
1 answer:
lozanna [386]3 years ago
5 0

The inheritance of colorblindness gene is X linked. Sally is a female, she'll have two copies of X chromosomes. Since she is not colorblind indicates that she is a carrier of the gene, the presence of at least one functional gene on either of the X chromosome in Sally prevented colorblindness in her. The chances that her husband will have a colorblind child is 25% (1:3) and 50% for the colorblind son (1:1),based on the solved punnett square in the image, where X' denotes the colorblindness gene.

You might be interested in
A line passes through the points( -3,-4) and (6,2)
andre [41]
What are you asking? Slope? If so. You would do change in y over change in x. So subtract 2 and -4 to get positive 6, then subtract 6 and -3 to get positive 9. Your slope is either 1/3 if it’s increasing, or negative 1/3 if it’s decreasing.
3 0
3 years ago
Read 2 more answers
A client develops a deep vein thrombosis after surgery. which alteration in the client's condition may indicate that the client
Galina-37 [17]
Shortness of breath, increase anxiety, confusion lethargy
5 0
3 years ago
Which of the following cases represents the phenomenon of contact inhibition?
SOVA2 [1]
The correct answer is (b.) growth of a tumor. A growth of a tumor is a case that represents the phenomenon of contact inhibition. Normal somatic cells will become growth inhibited when they encounter another cell.Growth mechanisms are to stop any further cell growth.
6 0
3 years ago
Read 2 more answers
Mutation will always result in the formation of a deadly tumor, or the development of a major body defect.
katovenus [111]
Mutations also occur because of incorrect copying of information in Mitosis.
4 0
3 years ago
When a tissue has become sensitized from a maladaptive immune response toward a normally harmless substance___________ has occur
IrinaVladis [17]

Answer:

hypersensitivity

Explanation:

3 0
4 years ago
Other questions:
  • Select all that apply.<br><br> How are protists different from bacteria and archaea?
    6·1 answer
  • The organism shown in the figure below is an example of:
    9·1 answer
  • Give reason for : the plants with falling leaves can do the transpiration process in
    14·1 answer
  • 33. Meiosis and sexual reproduction each lead to variation in the genetic make-up of every person.
    5·1 answer
  • Which two pieces of fossil evidence support the idea of continental drift?
    8·2 answers
  • Native people in the Amazon Rainforest use a toxin to help them catch fish. The toxin interferes with the gas exchange in the fi
    14·1 answer
  • Is it still considered cannibalism if you eat yourself (like a part of yourself)
    14·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Which of the following molecules lack amino acids
    14·1 answer
  • Why are bacteria called the borderline between plants and animals​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!