1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dedylja [7]
3 years ago
12

How did the occurrences of the different traits change over the 30-year period? Use evidence from the graph to support your answ

er. Using what you know about natural selection and adaptation, what generalization can you make based on these changes?
Biology
2 answers:
Svet_ta [14]3 years ago
8 0

Answer:

  • <u>Natural selection and adaptation:</u>

Living organisms are always in the process of adaptation to the surroundings or the environment in which it lives from one generation to another. As, over centuries men are also subjected to evolution.

  1. <u>Men living in the high grounds and those living in the lower altitudes:</u>We can analyze the case of people living in the different regions across the globe. As there are difference among the skin tone, there heart rate and the instinct to survive in harsh conditions. Because, if a generation of people migrates from a lower altitude region into a area of higher altitude then there will be an evolution or set of changes inside the living being body mechanism or more over cellular activities. And thus there kids will have a more capacity in terms of enduring the low rate or level of oxygen in the higher altitudes regions.So, it can be analyzed over the period of one and half decade of time duration, to see how the different individuals evolve through time as per the conditions provided to it.
  2. While there can be also the changes seen in the skin tone of the people who's ancestors have migrated long before they were born in the high altitude areas.

antiseptic1488 [7]3 years ago
7 0

<u>Answer:</u>

<em>Darwin was a British naturalist UN agency planned the idea of biological evolution by survival of the fittest. </em>

In <em>living organisms, several characteristics are transmissible, or passed from parent to offspring</em>.

(Darwin knew this was the case, even supposing he didn't understand that traits were transmissible via genes.)

Organisms are capable of manufacturing a lot of offspring than their environments will support.

<em>Thus, there's competition for restricted resources in every generation. </em>

The offspring in any generation are slightly totally different from each other in their traits<em> (colour, size, shape, etc.), and lots of of those options are genetic. </em>

<em>To make survival of the fittest a lot of concrete, let's take into account a simplified, theoretic example.</em>

During this example, <em>a gaggle of mice with genetic variation in fur colour (black vs tan) has simply touched into a brand new space wherever the rocks are black. </em>

<em>This surroundings options hawks, that prefer to eat mice and may see the tan ones a lot of simply than the black ones against the black rock. </em>

Because the hawks will see and catch the tan mice a lot of simply, a comparatively giant fraction of the tan mice are consumed, whereas a way smaller fraction of

<em>If we glance at the quantitative relation of black mice to tan mice within the living ("not-eaten") cluster, it'll be more than within the beginning population </em>

You might be interested in
Why are nitrogen-fixing bacteria important?
boyakko [2]

Answer:

Most organisms cannot obtain nitrogen from the atmosphere. Nitrogen fixing bacteria take Nitrogen out of the atmosphere and make it available for consumption by the other organisms, This is important because Nitrogen is an essential building block of life.

4 0
3 years ago
The term body mechanics describes the proper use of your body to lift without injury. What are the three considerations to revie
Artist 52 [7]

Answer;

-The​ object, your​ limitations, and communication

Explanation;

-Body mechanics involves the coordinated effort of muscles, bones, and the nervous system to maintain balance, posture, and alignment during moving, transferring, and positioning patients.

-Proper body mechanics allows individuals to carry out activities without excessive use of energy, and helps prevent injuries for patients and health care providers.

6 0
3 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
There are many different categories of T-cells that carry out various roles for the immune system. Differentiation for most T-ce
Likurg_2 [28]

Answer:

The answer is actually B) Memory T. Memory T cells rapidly produce large numbers of effector T-cells when re-exposed to their antigens, which provides the immune system  memory against past infections.

7 0
2 years ago
Read 2 more answers
A propagation flat with dimensions of 18"x8"x2" has the following volume
Lynna [10]

Explanation:

Volume = 18×8×2 =288 (units)³.

please put the unit as follows in the question.

hope this helps you.

8 0
3 years ago
Other questions:
  • A 55 kg person on Earth has the __________mass on the moon.
    15·1 answer
  • Como se llama el presidente del estado unido
    11·1 answer
  • What is the special features of the rock chert?
    8·2 answers
  • Knowing that chaparral biomes are comprised mostly of low-growing shrubs, what adaptations have sage, rosemary, thyme, and orega
    8·2 answers
  • The excretory system rids the body of toxic chemicals, excess water, salts, and carbon dioxide while maintaining osmotic and ph
    15·1 answer
  • If Earth were replaced by an object with the same mass but much smaller in size, would the moon continue to orbit the new object
    14·1 answer
  • Question 12 of 15<br> A force is a push or pull.
    14·2 answers
  • State two differences between respiration and breathing​
    12·1 answer
  • Image B depicts three skulls. Do you think the image supports the fact that all three organisms share an evolutionary relationsh
    10·1 answer
  • Transportation of seedling is not done for<br>1 rice <br>2 maize <br>3 onion <br>4 brinjal ​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!