1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inn [45]
3 years ago
10

Identify the major similarities and differences between prokaryotic and eukaryotic cells

Biology
1 answer:
jarptica [38.1K]3 years ago
6 0
<span>Eukaryotic cells contain membrane-bound organelles, including a nucleus. Eukaryotes can be single-celled or multi-celled, such as you, me, plants, fungi, and insects. Bacteria are an example of prokaryotes. Prokaryotic cells do not contain a nucleus or any other membrane-bound organelle.</span>
You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
In what ways do cells use energy
Salsk061 [2.6K]

Image result for In what ways do cells use energy

Cells do not use the energy from oxidation reactions as soon as it is released. Instead, they convert it into small, energy-rich molecules such as ATP and nicotinamide adenine dinucleotide (NADH), which can be used throughout the cell to power metabolism and construct new cellular components.

6 0
3 years ago
Which atoms and/or ions expand in all directions?
GenaCL600 [577]

Gaseous atoms and plasmic ions expand in all directions.

7 0
3 years ago
Read 2 more answers
What is the difference between cell division and replication?
WITCHER [35]
Cell division is when the cell divides its chromisomes. Replication is when it replicates or makes another dna molocule like it. 
7 0
3 years ago
How does ATP synthase produce ATP
Helen [10]

<span>In the presence of oxygen, one glucose molecule has the energy to make up to 38 ATP. The ATP production is determined by the following steps, (-2 ATP) glycolysis preparatory phase, (7-9 ATP) glycolysis pay-off phase, (5 ATP) oxidative decarboxylation of pyruvate and (20 ATP) Krebs cycle. One glucose which has 38 ATP hence was the summation of all the process mentioned that took place.  All these process take place under the cellular function of cellular respiration. </span>
6 0
3 years ago
Other questions:
  • The amphetamine speed is classified as a _____.
    9·2 answers
  • It has been projected that by 2025 _______ people will suffer from water shortages. a. 1 out of 3 b. 2 out of 3 c. 3 out of 3 d.
    12·2 answers
  • The table shows the solubility of two substances in water at 20°C.
    14·1 answer
  • What causes plates to move on the mantles surface?
    14·1 answer
  • Describe the general composition of a protein molecule.
    6·1 answer
  • What happens during the transcription?
    9·1 answer
  • paragraph explaining how energy flows through energy pyramid trophinc level producer primary consumer desompsor sun secondary co
    11·1 answer
  • How does the Griffith experiment connect to the Meselson &amp; Stahl experiment? How does this experiment support Meselson &amp;
    14·1 answer
  • When you put observations together with what you already know you make a(n)
    7·1 answer
  • Describe three abiotic and three biotic components of an ocean marine ecosystem, Please Help Now!!
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!