Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Image result for In what ways do cells use energy
Cells do not use the energy from oxidation reactions as soon as it is released. Instead, they convert it into small, energy-rich molecules such as ATP and nicotinamide adenine dinucleotide (NADH), which can be used throughout the cell to power metabolism and construct new cellular components.
Gaseous atoms and plasmic ions expand in all directions.
Cell division is when the cell divides its chromisomes. Replication is when it replicates or makes another dna molocule like it.
<span>In the presence of oxygen, one glucose molecule has the energy to make up to 38 ATP. The ATP production is determined by the following steps, (-2 ATP) glycolysis preparatory phase, (7-9 ATP) glycolysis pay-off phase, (5 ATP) oxidative decarboxylation of pyruvate and (20 ATP) Krebs cycle. One glucose which has 38 ATP hence was the summation of all the process mentioned that took place. All these process take place under the cellular function of cellular respiration. </span>