Hydrophilic (water-loving) or could be called water, it mean attracting water molecules as close as possible, the phospholipid is made up of a head that is polar, and a tail that is non polar or in another words called “hydrophobic” , this means that the head of the phospholipid is attracted to water molecules ( this helps you understand the structure of cell membrane formation). Steriod, a class of lipids, some hormones like cholesterol are made up of steroids. They maintain fluidity of cell membrane. Example: oestrogens
Answer:
The form of cell to cell signalling that is been used is ENDOCRINE.
Explanation:
There are four ways by which cell signalling occur in the body, these are: endocrine, paracrine, autocrine and direct signalling.
Endocrine signalling is the biochemical process by which hormone secreting glands release hormones into the blood streams and that hormone has effects on target organs that are located far away from it. Endocrine hormones are usually stable and their effects usually last for long time.
Answer for this question will be
3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'
Answer:
The atom, the basic building block of matter, consists of a core nucleus surrounded by negatively charged electrons. Inside the atom nucleus contains a mixture of positively charged protons, and electrically neutral neutrons. All atomic electrons bind to the nucleus through electromagnetic force. A ground of electrons bound together will form individual molecules. An atom with an equal number of protons and electrons will hold neutral. An ion has positive or negative charge, either through a lack of electrons or an electron excess. The number of protons determines the formation of chemical elements, while as the number of neutrons determines the element's isotope. Most of the atom's mass has a concentration compacted within its nucleus; however, protons and neutrons hold about the same mass. Electrons bound to atoms hold a percentage of stable energy levels, otherwise known as orbitals, which undergo transitory processes through absorbing or omitting photons with equal energy levels. Electrons determine an element's chemical properties, thus influencing an atom's magnetic properties.
Explanation:
it would be most likely A.
since female sea turtles usually tend to use up mid may to almost august they usually visit more than once since they lay 150+ eggs.
