1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lostsunrise [7]
3 years ago
8

Describe what the layers of the earth are made of and their approximate temperature.

Biology
1 answer:
Pavlova-9 [17]3 years ago
4 0

Crust- topmost layer, made out of solid silicate rocks like basalt and granite, 200 C to 400 C

Mantle- composed of rocky oxides and silicates 500 C to 900 C

Core- mostly iron, or other metals 6,000 C

You might be interested in
promoters are sequences of rna that are the start signals for tha transcription of mrna true or false
Simora [160]
False              jbuivlyhlvvgkuvuly
6 0
3 years ago
Read 2 more answers
Which mechanism do prey use to blend into their surroundings, making it hard for predators to spot them?
Elan Coil [88]
E. Caomouflage is what prey use to blend into their surroundings.
3 0
3 years ago
Read 2 more answers
Which set of terms below would be the best choice to use to describe the components of blood? 1.leukocytes, ventricle, atrium, a
Harlamova29_29 [7]
The answer is (2.) platelets, plasma, erythrocytes, and leukocytes.
6 0
3 years ago
One celery stick is placed in a beaker of pure (100%) water. A different celery stick is placed in a beaker of an 80% water and
Sergio039 [100]

Answer: In the case of the celery in salt water, water would leave the cells and the stalk will become wilted.

In the case of the beaker with plain water, the water will move into the cells in the stalk. You would see this better if the stalk was already wilted.

Explanation:

5 0
3 years ago
How has this understanding affected the field of medicine?
RoseWind [281]

Answer:

This question is to vague. What understanding?

Explanation:

5 0
4 years ago
Other questions:
  • Cell cycle regulation how does a cell know it is time to divide
    7·1 answer
  • How many muscles are there in a human body?
    13·1 answer
  • Where is desertification likely to occur
    13·2 answers
  • How are malignant tumors different from benign tumors?
    12·1 answer
  • How would you explain the process of different species of birds on different islands that are in close proximity to each other?
    6·1 answer
  • What element is a nonmetal ci,fe,mg,zn
    6·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • PLS HELP!!!!!! to answer these questions fill in the blank with the answer. A _________ is a single-celled biotic pathogen that
    15·1 answer
  • How can intensive agricultural practices contribute to climate change?
    8·1 answer
  • Complete the following sentence. _______ measure air temperature and _________ measure air pressure.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!