1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inessss [21]
3 years ago
14

Help me fill in 1, 2, 3 on my notes?

Biology
2 answers:
shepuryov [24]3 years ago
7 0

1. Messenger RNA brings genetic information (protein code) from the nucleus to the ribosomes in the  cytoplasm.

2. Tranfer RNA carries amino acids from the cytoplasm to the ribosomes.

3. Ribosomal RNA comprises the majority of ribosome,that assembles amino acids into proteins according to the mRNA code.

Nana76 [90]3 years ago
3 0
1) Messenger
2) Transfer
3)Ribosomal
You might be interested in
What is the difference between population and organism?
Ostrovityanka [42]

An organism describes an individual. You are an organism. I am an organism. The mosquito that flies by your window is an organism. An organism is a single, living thing and can be an animal, a plant, or a fungus. Organisms grow and respond to their environment.

A population is the term we use to describe multiple individuals or organisms of a single species that live within a particular geographic area. For example, there may be one population of painted turtles in one state and another population of painted turtles 250 miles away in another state.

3 0
3 years ago
Hi, please answer this
Dima020 [189]

Answer: I wanna say that’s right

Explanation:

8 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
How would you use mutaulism in a sentence?
Ymorist [56]
 mutualism is a mutual relationship such as co-ownership of property where both parties benefit.

<span>

</span>
6 0
3 years ago
Diffusion is the_______________________________________________________
Dmitry_Shevchenko [17]

Answer:

Diffusion is the movement of a substance from an area of high concentration to an area of lower concentration.

Explanation:

Diffusion occurs in liquids and gases when their particles collide randomly and spread out. Diffusion is an important process for living things - it is how substances move in and out of cells.

5 0
3 years ago
Other questions:
  • The early organisms on earth also needed to brake down glucose to energy to survive. which of the following processes did they m
    12·2 answers
  • Which type of ecosystem is most likely to be characterized by thick, rich soils?
    9·2 answers
  • What part of the brain controls certain reflexes and coordinates the body's movements?
    8·1 answer
  • MARKING AS BRANLIEST
    5·2 answers
  • Why is reproduction considered as a life function?
    9·2 answers
  • What is the purpose of having ampicillin in the plate?
    11·1 answer
  • Which of the following is the appropriate response when the National Weather Service issues a severe weather warning?
    14·2 answers
  • ____has the most control of traits and inheritance?
    12·2 answers
  • Hypothesis: If a higher percentage of people are immune to a disease, then the disease will spread more slowly, because fewer pe
    12·2 answers
  • Natural selection may affect allele frequency in populations due to the fundamental forces of evolution except which of the
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!