Ask question

Ask question

All categories

2 years ago

13

This is the foundation for DNA replication, the rule that states the pure adenine (A) always pairs with the pyrimidine thymine (

T) and the pyrimidine (C) always pairs with the purine guanine (G)?

2 answers:

Alenkasestr [34]2 years ago

6 0

It might be always pairs with the purine guanine

Varvara68 [4.7K]2 years ago

3 0

Its A Hope I helped give brainliest

You might be interested in

Enzyme Activity and pH

sveticcg [70]

Explanation:

B) After determining the optimum pH, they could vary the temperature of the environment to see if catalase is temperature specific

Enzymes are proteins which catalyze reactions by acting on substrates in order to speed up reactions- like the breakdown of large polysaccharides by amylase. Here, the enzyme catalase facilitates the breakdown of hydrogen peroxide into oxygen and hydrogen. Catalase specificity is affected by pH, temperature and the presence of inhibitors.

In temperatures beyond its optimal range, catalase may undergo changes to its physical structure called denaturation; when denatured, enzymes lose their ability to bind specifically to their substrate -i.e. substrate binding specificity is lost. H2O2 would no longer be able to bind to the active site, and thus would not be broken down.

Learn more about cellular life at brainly.com/question/11259903

Learn more about proteins and carbohydrates at brainly.com/question/10744528

#LearnWithBrainly

3 0

3 years ago

Which theory was revised to obtain the theory of plate tectonics?

Inessa [10]

Continental Drift Theory!!

Hope this helps...have a good day!!;)

5 0

3 years ago

Read 2 more answers

What is the cause of lightning?

Zolol [24]

Answer:

The different elevations of a cloud and the ground

7 0

2 years ago

Read 2 more answers

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

5’-TGCCTAGGAGGGATCACGCATTATGC-3’

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the <u>coding strand</u>, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

Start codon ⇒ ATG
Stop codon ⇒ TAA, TAG, TGA

5´- GCATA<u>ATG</u>CGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCA<u>TAA</u>TGCG<u>TGA</u>TCCC<u>TAG</u>GCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATT<u>ATG</u>C-3’⇒ 1 start codon near the end

5’-TGCC<u>TAG</u>GAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. <em>However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.</em>

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0

3 years ago

When comparing maxillary and mandibular lateral incisors the mandibular incisor crown is wider mesio-distally than the mandibula

Viefleur [7K]

Answer:

Mammalian dentition is characterized by heterodonty, in which both the upper and lower teeth are differentiated morphologically into four types: flat, chisel-shaped incisors, conical canines, bicuspid premolars and multicuspid molars in the mesiodistal direction.

Explanation:.

<u>The mesiodistal crown:</u>dimension is the smallest of any maxillary teeth.The mesiodistal measurement of the pulp chamber is wider compared to the labiopalatal one. The periphery of the socket often dips down palatally, labially, mesially and distally to accommodate the shape of the root.

<u>Maxillary central incisor:</u>The general shape is similar to maxillary central incisor except that they are shorter and narrower. It has the most cervically located contact area of any incisor. The mesioincisal and distoincisal angles are more rounded than the corresponding angles of maxillary central incisor.

<u>Permanent mandibular central incisor:</u>The crown dimensions are the smallest of any tooth, it has bilaterally symmetrical crown, and the line angles are the sharpest of any tooth.It shows the shallowest labial developmental grooves, smoothest lingual surface contour and the least developed cingulum.

3 0

3 years ago