1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
quester [9]
3 years ago
5

Describe the differences between a positive and negative charge

Biology
2 answers:
Fofino [41]3 years ago
4 0

Answer:

A differences between positive and a negative charge is that a positive has more charges then a negative

Explanation:

say if you have a batrry with a negative charge it will not work

Shalnov [3]3 years ago
3 0
Everybody knows that positive charge is due to protons and negative charge is due to electrons, but what does the charge mean?
Why were negative and positive charges so designated?
Was it also a possibility to call the charge of an electron positive and the charge of a proton negative?
You might be interested in
In coastal areas, wind moves sand, blowing away or engulfing the soil, and eventually creating sand dunes
fomenos
In physical geography<span>, a </span>dune<span> is a </span>hill<span> of loose </span>sand<span> built by </span>wind<span> or the flow of water.</span><span> Dunes occur in different shapes and sizes, formed by interaction with the flow of air or water. Most kinds of dunes are longer on the windward side where the sand is pushed up the dune and have a shorter "slip face" in the lee of the wind. The valley or trough between dunes is called a </span>slack<span>. A "dune field" is an area covered by extensive sand dunes. Dunes occur, for example, in some </span>deserts<span> and along some coasts.</span>
4 0
2 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
All of the following is leading to less habitable land for human populations except…
grandymaker [24]

Answer:

Scarcity of freshwater.

Explanation:

8 0
2 years ago
Contrast flagella and pili. what are their functional roles?
gogolik [260]
Both flagella and pili are extensions from the bacterial cell body. Flagella are like a whip or a tail while pili are best described as hairlike.A pilus is a hairlike appendage found on the surface of many bacteria.
7 0
3 years ago
Why is it good sanitary practice to wash dishes immediately after a meal?
levacccp [35]
The reason why good sanitary practice should be observe and done especially in terms of washing dishes immediately after a meal in order to prevent bacteria from going and by this, it makes the enviroment more clean and more safe to people to live in. It is because when plates or used utensils are not cleaned after having it used, bacterial growth could sprout, making the environment dirty and dirt could interfere with someone's health into having them acquire illness that would also affect not only one person but also other people living in the house. That is why good sanitary practice is observed, not only because it promotes cleanliness but it is also because for the better health of the individuals.
6 0
3 years ago
Other questions:
  • Based on the current understanding of this operon, which hypothesis would be useful for James to test?
    15·1 answer
  • Lawrence Kohlberg built on the theories of _____ in his description of the stages of moral development. A. Carol Gilligan B. Jea
    10·1 answer
  • The component parts of the term ophthalmalgia meaning pain in the eye are _____
    14·1 answer
  • Religious involvement often results in _____ drug use
    5·2 answers
  • Suggest why drugs that prevent reflex action from occurring should be avoided
    12·1 answer
  • What are the subunits of insulin
    10·1 answer
  • Can someone help me with this question?
    10·1 answer
  • Why would the tissues of a leaf need to have the ability to resist changes in pH in their natural environment?
    12·1 answer
  • I'll give brainliest to the person with the correct answer​
    11·2 answers
  • Which of the choices below describes the pathway of cellular respiration (the complete oxidation of glucose)? lipolysis, glycoge
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!