What happens to the fluid filtered from blood capillaries?

Biology

1 answer:

Elden [556K]4 years ago

3 0

<h2>Answer is option "a"</h2>

Explanation:

A broad measure of fluid breaks from the blood spread each day. An extensive amount of liquid breaks from the blood dissemination every day. Except if this liquid is consumed by the lymphatic framework, an excessive amount of liquid will amass in the interstitial spaces and growth will occur The key capacity of lymph is to send blood parts back to the circulatory framework and keep up the correct volume of blood scattering.
The interstitial fluid is fluid that has spilled from the blood stream and contains platelets and proteins which are fundamental parts of blood Except if these segments have come back to the circulatory system, the volume of blood in an individual's body may get inadequate.
Hence, the right answer is option a " it becomes interstitial fluid, enters lymphatic vessels, and is returned to the bloodstream."

You might be interested in

What is the source of oxygen in the epipelagic zone?

Rudiy27

The correct answer is (B) Photosynthesis and diffusion from the air

Dissolved oxygen enters the water from photosynthesis and through air. The The aeration of water can be caused by wind. From the air oxygen diffuse into the water and gets mixed in the it through circulation. The oxygen is also produced as a waste product of photosynthesis from blue-green algae, phytoplankton, etc which is added in water.

7 0

3 years ago

It is crucial to study ocean microbes because _______. a. they control the major biogeochemical cycles that keep Earth’s biosphe

Daniel [21]

A is the answer i believe. ^>^

6 0

4 years ago

Read 2 more answers

How do earthworms get oxygen to their cells?

Ksju [112]

They breathe through their skin. Air dissolves on the mucus of their skin, so they MUST stay moist to breathe.

If worms dry out, they suffocate. As fresh air is taken in through the skin, oxygen is drawn into the worm's circulatory system, and the worm's hearts pump the oxygenated blood to the head area.

7 0

3 years ago

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0

3 years ago

During which process is ethanol produced?

Kipish [7]

Answer:

Alcohol fermentation

Explanation:

When oxygen availability is low, the cell can't perform aerobic respiration to breakdown glucose. Instead, anaerobic respiration must be performed. This occurs in cells which consume large amounts of energy, such as muscle cells. Anaerobic respiration produces much less energy than aerobic respiration

One type of anaerobic respiration formed by yeast is called alcohol fermentation (also called ethanol fermentation). This begins with glycolysis, where one molecule of glucose is broke down into 2 molecules of pyruvate. The energy from this reaction generates 2 molecules of ATP, and converts NAD+ to NADH.

Then, the two molecules of pyruvate are further broke down into 2 acetaldehydes (releasing two molecules of carbon dioxide as a by-product). These two molecules of acetaldehyde are then converted into tw molecules of ethanol, using the H ions from NADH, converting it back to NAD+. See the attached picture

This process is taken advantage of to brew beer and wine.

3 0

3 years ago

Read 2 more answers