Answer:
Explanation:
Type 2 diabetes is a disease in which blood sugar levels are above normal. High blood sugar is a major cause of heart disease, kidney disease, stroke, amputation, and blindness. In 2009, diabetes was the seventh leading cause of death in the United States.
Cell maintain homeostasis through diffusion in isotonic solution. Isotonic means that the concentrations are the same on either side of the membrane, maintaining homeostasis.
The goal of the World Resources Simulation Center (WRSC) is best described as: C. determining how to manage global resources for all humanity.
<h3>What is the World Resources Simulation Center (WRSC)?</h3>
The World Resources Simulation Center (WRSC) can be defined as a non-profit visualization and simulation facility that is saddled with the responsibility of availing individuals an opportunity to view critical trends about global global resources.
This ultimately implies that, the goal of the World Resources Simulation Center (WRSC) is best described as determining how to manage global resources for all humanity.
Read more on global resources here: brainly.com/question/18951815
#SPJ4
Answer:
The acidity level of water is measured by the pH scale. Pure water has a pH of 7, which is neutral. However, natural rainwater actually has a pH of 5.6 because it gets exposed to the gases in the atmosphere, making it a bit acidic. True acid rain will have a pH level measuring from 5.0-5.5.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
