the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'
the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand
so for reference heres a little cheat guide
Adenine=Thymine
Thymine=Adenine
Guanine=Cytosine
Cytosine=Guanine
Phylum is the correct answer
Answer:
The correct statements are:
- Meiosis results in four haploid daughter cells.
- During meiosis, the 2N mother cells produce N daughter cells.
- In both processes, DNA replication must occur.
- Mitosis is responsible for genetic continuity; in higher organisms, it is essential for growth and repair.
Mitosis is a type of cell division in which a parent cell is divided into two identical daughter cells. Each daughter cell contains identical genetic material as that of the parent cell.
It plays important role in growth and repair of cells and tissues in multi-cellular organisms.
Meiosis is a type of cell division in which a parent cell is divided to produce four daughter cells. Each daughter cell contains exactly half the genetic material (chromosomes) as that of parent cells
It plays important role in the production of gametes (eggs and sperms) in sexually reproducing organisms.
Before either cell division, the DNA is replicated in the S or synthesis phase of the cell cycle.
Answer:
The options are missing, the options are:
A) prevents the duplication of centrosomes. B) prevents nuclear envelope fragmentation C) prevents shortening of microtubules. D) prevents attachment of the microtubules to the kinetochore. E) prevents nucleosome formation
The answer is C
Explanation:
Cell division is a characteristics of all living cells. Whether meiosis or mitosis, the chromosomes separate in the Anaphase stage. Prior to the anaphase stage is the metaphase, where spindle microtubules attach to the kinetochores of each chromosome and aligns them at the centre of the cell called METAPHASE PLATE.
Thus, since the aligning of chromosomes at the metaphase plate has to do with attachment of microtubules to chromosomes' kinetochores, the drug that will hinder movement of chromosomes to opposite poles will not stop formation of microtubules. Instead, it will prevent the formed microtubules attached to each chromosome from shortening, as it is the shortening of microtubules that facilitates the pulling apart of the chromosomes they are attached to.
12) its harder for the cell to move around due to the extra volume and mass
13) product; reactant
14)the nucleus
15)tissues comes before the organ
16) prokaryotic and eukaryotic
17) prokaryotes do not have a nucleus
18) cell
19) the bass
20) it allows needed materials to move in and out of the cell
21) DNA flagella and nucleus
22) the higher power objective
23)
