Answer:
250 years
Explanation:
The Atlantic Ocean is not static, but instead it is very active, and it is actually spreading from its central part. In its central part, this ocean has a mid-ocean ridge. This basically means that there is constant formation of new crust from the magma that comes out, and the old crust is pushed sideways as the new one is formed. On an annual level, the mid-ocean ridge is spreading out by an estimated 0.02 meters, thus that is how much the Atlantic Ocean is spreading out each year. In order to get to the result as to how many years are needed for the Atlantic Ocean to spread 500 cm, we just need to multiply the annual spreading with the number of cm in question:
0.02 x 500 =250
Thus we get a result of 250, meaning that in 250 years the Atlantic Ocean will spread out 500 cm in total.
Answer:
Sulfas = Sulfonamide
Sulfonamide is a group that is the basis of many groups of drugs.
Sulfa drugs work by binding and inhibiting a specific enzyme called dihydropteroate synthase. This enzyme is critical for the synthesis of folate, an essential nutrient.
plz mark me as brainliest :)
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
vapor and elastic potentiol energy
Explanation:
Answer:
Enzymes speedup the chemical reaction.
Explanation:
Enzymes are the molecules which are responsible for speedup of the chemical reaction. In this picture, we can see substrate attached to the active site of the enzyme. This enzyme speedup the chemical reaction and products are formed after completion of chemical reaction. When the chemical reaction is over, the products detached from the enzyme and no decrease occurs in the size of enzyme.
