1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svlad2 [7]
3 years ago
13

Consider the following mRNA strand: CCAUGGCAAAGGAGUGACUAA

Biology
1 answer:
Nitella [24]3 years ago
3 0

Answer:

If it helps, I only know the mRNA to DNA conversion:

GGT CCG TTT CCT CCT GTT

Explanation:

You might be interested in
What is the function of Nucleic Acids?
Tanya [424]
They contain genetic information and assist in making proteins
8 0
3 years ago
Water shape creates a positive and negative side to it. This shape then creates what characteristics of water?
miskamm [114]
D high specific heat
3 0
4 years ago
Helppppppppppppppppp
Alenkasestr [34]
Bruh you literally just gotta look up the word and give an example
3 0
3 years ago
Leaf cutter ants spend their day harvesting leaves and bringing them back to the hive. However, those ants do not eat leaves, bu
goldfiish [28.3K]

Answer:

B) Mutualism

Explanation:

In mutualism both organisms benefit. The organisms in this example are the fungus and the ants. The ants provide food to the fungus so that it can live. In return the fungus provide food for the ants.

4 0
3 years ago
A diverse group of mostly single celled organisms are called
Debora [2.8K]

Explanation:

the answer is not A, B,D now get it it is Clear C protists

6 0
3 years ago
Other questions:
  • Which of the following statements is true about biomes?
    11·1 answer
  • It is thought that cause past Ice Age climate
    7·1 answer
  • Is it normal to have residual bleeding after a catheter removal?
    7·1 answer
  • Do plant cells perform cellular respiration?
    8·1 answer
  • Regulation of expression of genes is important because: Group of answer choices A. some genes function in opposition to other ge
    6·1 answer
  • The main building blocks of tissues and organs are
    13·2 answers
  • It took 1649 years for the world population to double, going from .25 billion people to .50 billion people. How long did it take
    9·1 answer
  • The nitrogenous bases in DNA are held together by... A. Covalent Bonding
    9·1 answer
  • In a well-constructed paragraph, answer the question below.
    9·1 answer
  • Please help i am giving brainiliest
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!