1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svlad2 [7]
3 years ago
13

Consider the following mRNA strand: CCAUGGCAAAGGAGUGACUAA

Biology
1 answer:
Nitella [24]3 years ago
3 0

Answer:

If it helps, I only know the mRNA to DNA conversion:

GGT CCG TTT CCT CCT GTT

Explanation:

You might be interested in
Fossils usually provide paleontologists with information about each of the following except an organism''s structure. environmen
faltersainse [42]
Fossils usually provide paleontologists with information about each of the following except <span>Fossils usually provide paleontologists with information about each of the following except DNA</span>
4 0
4 years ago
Read 2 more answers
True or False? Understanding what motivates employees in different generations is becoming increasingly important for healthcare
JulsSmile [24]

Answer:

Yes it is true that understanding what motivates employees in different generations is becoming increasingly important for healthcare managers.

Explanation:

  • It is absolutely a wrong concept that employees are motivated by their salary or amount of money.
  • The motivation differs from person's personality, their age generation and many other factors.
  • An employee's motivation is dependent upon believe that they can execute the task and they will receive the valued outcomes.
  • So, heath care managers must be highly conscious about knowing their employee in term of their motivations and self satisfaction.
5 0
3 years ago
Macroevolution _____. select all that apply.
Rasek [7]

Answer:

C

Explanation:

lol it says it in the question which ones are correct

8 0
3 years ago
Many different types of mutations can occur within the body. Tay-Sachs disease is a deadly disorder that is caused by a missing
ZanzabumX [31]

Correct answer: D). Deletion

Tay-Sachs disease is an autosomal hereditary disease that is known to affect the central nervous system. It results from the mutation caused in the gene that encodes for the beta-hexosaminidase enzyme. It is a lysosomal enzyme that is composed of the beta and alpha polypeptides.

It is caused when both the parents are a carrier, it occurs when a baby is born in absence of hexosaminidase. It affects the nervous system and can change the physical appearance after a few months of the birth.




6 0
3 years ago
Read 2 more answers
Rna contains the sugar
ioda

Answer:

RNA contains the sugar ribose.

Explanation:

An RNA molecule is made of nitrogenous bases (A, U, G, and C), phosphate groups, and the sugar <em>ribose. </em>

3 0
3 years ago
Other questions:
  • A cross between two plants that have pink flowers produced plants that have red , pink, or white flowers. What is the most likel
    7·1 answer
  • Should Marta have asked Chiang to write an article based on her results? If you read Chiang’s article, would you trust it? Expla
    7·2 answers
  • what order do the changes in the succession of an ecosystem occur? Rearrange the boxes so that the first change to occur is on t
    12·1 answer
  • There is a pandemic of a contagious disease in the untied, states, there is only enough of th vaccine to cover 70% of the popula
    11·1 answer
  • The ___ of ATP are the key to its ability to store and supply energy
    6·1 answer
  • Why has the medical industry changed the procedures ?
    12·1 answer
  • Guys pls help me!!!!!!!!!!!
    13·1 answer
  • Which statements describe the effects of indoor pollution? Select two options.
    12·1 answer
  • The data in the graph are the result of a paramecium being placed in a hypertonic salt solution.
    5·1 answer
  • The part of the eye through which light travels
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!