1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svlad2 [7]
3 years ago
13

Consider the following mRNA strand: CCAUGGCAAAGGAGUGACUAA

Biology
1 answer:
Nitella [24]3 years ago
3 0

Answer:

If it helps, I only know the mRNA to DNA conversion:

GGT CCG TTT CCT CCT GTT

Explanation:

You might be interested in
Create a list of 5 potential jobs that students of neurology can obtain.
d1i1m1o1n [39]

Answer:

Explanation:

Machine Learning Engineer.

Neurosurgeon.

Neuroscience Researcher.

Pharmaceuticals Scientist.

Cognitive Neuroscientist.

8 0
3 years ago
Read 2 more answers
Drugs that often lead to the use of other more serious drugs are known as __________ drugs.
bezimeni [28]
They’re known as gateway drugs.
4 0
3 years ago
Explain how slumping or soil creep occur. Will hit heart❤️
Mrac [35]

Answer:

Slumps often happen when a slope is undercut, with no support for the overlying materials, or when too much weight is added to an unstable slope. Creep is the imperceptibly slow, steady, downward movement of slope-forming soil or rock.

5 0
3 years ago
Poniżej podano funkcje elementów budujących układ oddechowy. Zaznacz odpowiedź dotyczącą płuc. Jest narządem odpowiedzialnym za
Mandarinka [93]

Answer:

umm how is this a question?

3 0
3 years ago
A serving of food contains 15 g carbohydrate, 3 g protein, 5 g fat, 5 mg vitamin c, and 100 ml water. based on this information,
Levart [38]
117kcal. To know the total kcal, we first have to determine the conversion rate for carbohydrates, fat, protein, water, and grams of vitamins.

Here are the conversion rates:

4kcal per gram of protein.
4kcal per gram of carbohydrate.
9kcal per gram of fat. 
0kcal per gram of vitamin.
0kcal per milliliter of water

From the given values, we can say that the food serving gives 117kcal. 
3 0
3 years ago
Other questions:
  • if i used 10mL of an inorganic catalyst (enzyme) inba reaction how much would be left over after the reaction was done?
    13·2 answers
  • What do the tympanic membranes do for the frog?
    5·1 answer
  • What are 5 things that houdini did that helped him develop into a escape artist?
    15·1 answer
  • What are steroid hormones most similar to?
    7·2 answers
  • How does insect pollination benefit the insect?​
    5·1 answer
  • Fill in the blank<br><br> DNA IS NOT “TURNED ON” ALL OF THE _____ IN ALL OF THE CELLS.
    10·1 answer
  • List several functions of G protein-coupled receptors
    7·1 answer
  • Th I Determine which macromolecule is represented by the following examples.
    14·1 answer
  • Can some one help me :(.
    13·1 answer
  • Uring the follicular phase, granulosa cells secrete __________, which stimulates secretion of __________.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!