1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Levart [38]
3 years ago
11

What type of relationship does a cat and tapeworm have?

Biology
1 answer:
stellarik [79]3 years ago
7 0

Answer:

Parasitism.

Explanation:

Parasitism is an association in which one organism, lives on another, the host, deriving benefit from it and causing harm to it.

The tapeworm here is a parasite and it lives inside the cat's(host) body where the tapeworm is specialized for its mode of life. It survive and reproduces very well without needing another specie because it is a hermaphrodite. It causes loss or poor development of unwanted organs such as the digestive, sense organs and muscles. Its long flattened body also provides a large surface area for absorption of nutrients too.

You might be interested in
In a solution, the more abundant substance that dissolves another substance is known as what?
weqwewe [10]

Answer:

solvent.

Explanation:

the more abundant dissolving substance in a solution. supersaturated solution.

5 0
3 years ago
⚠️⚠️URGENT⚠️⚠️<br><br><br> Which advantage of reproduction<br> does the graph show? Explain.
Liula [17]

Answer:

The graph shows that the population of bacteria is increasing with the passage of time. During 1st hour, the population of bacteria is 50 per ml. In second hour, the population is doubled i. e. 100 per ml. In the 3rd hour, the population reaches to 200 per ml and in 3 and half hours, the population touches the value of 300 per ml. So the graph clearly shows that population is double with each hour.

7 0
4 years ago
Relationship between photosystem and pigment?
Svetach [21]
The relationship between them is chlorophyll because that is the only pigment that interacts with the light proteins by transferring excited electrons to the primary electron acceptor.
4 0
3 years ago
Which of the following is not one of the three ingredients needed to form a cloud? dust or solid matter of some sort water molec
andreev551 [17]
Wind and tempature and pressure changes
7 0
3 years ago
Which are true?
Pavel [41]

Answer:

C, D, E

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • A testable hypothesis could be formed from which question?
    16·2 answers
  • Scientists discovered that the Albert's squirrels became two separate populations during the Grand Canyon's formation; they are
    13·1 answer
  • The scales of female pine cones produce a sticky substance. what function might this serve?
    15·1 answer
  • A cell contains two sets of DNA. If the gene on one molecule
    14·1 answer
  • Photosynthesis is a very complex process that occurs when sunlight and _________ are present????
    12·1 answer
  • What are the raw materials for photosynthesis?
    5·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What amount of chromosomes will each daughter cell have after mitosis and cytokinesis?
    10·1 answer
  • How is mitosis and meiosis similar
    6·1 answer
  • Which of the following BEST explains why Earth is tectonically active?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!