1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scilla [17]
3 years ago
12

Which option is an example or a physical property?

Biology
2 answers:
Elodia [21]3 years ago
5 0
Well it i can be<span>, melting point, boiling point, density, solubility, polarity,

in your case d. a</span>s solid matter is heated it eventually melts :l
ipn [44]3 years ago
4 0
The answer is melting point
You might be interested in
What are the causes of the attractions and repulsions between molecules of water
Inessa05 [86]
The causes of the attractions and repulsion between molecules of water is that the oxygen and hydrogen atoms share electrons in bonds but its not equal. I hope this is the answer you are looking for! :)
8 0
3 years ago
What is the term used to identify a molecule responsible for reducing the amount of
Travka [436]
An enzyme. An enzyme is a protein speed up a biochemical reaction. It’s a catalyst.

Hope this helps :)
4 0
2 years ago
Read 2 more answers
After centuries of moderate weather, temperatures are increasing so much that forest fires are rampant.
nikdorinn [45]

climate change is the answer!

6 0
3 years ago
Read 2 more answers
Which of the following are organisms? (Choose all that apply)
PolarNik [594]
The answer to your question is bacteria
7 0
1 year ago
What do crops of the green revolution need in order to produce higher yields?
Airida [17]

Answer:

These crops where improved  with technology, production of high-yielding variety, and improve farm practices. All these ensured  the crops of green revolution had increase yield.

Explanation:

Through  genetic engineering, high-yielding variety of cereals e.g wheat, maize, rice, were genetically engineered so that certain features which enhanced increased productivity were selected for.

Use of fertilization, the adoption of mechanization,good cropping and farming system are other factors which enhanced yield of these crops. Specifically, these crops were modified to enhance their Nitrogen uptake, which promotes rapid growths.

4 0
3 years ago
Other questions:
  • What are some steps that scientist can take in designing an experiment to avoid false negatives
    12·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • BIOLOGY EXPERTS HELP!!! Which of the following examples poses the greatest potential threat to an ecosystem’s biodiversity?
    9·1 answer
  • What type of trait vary quantitatively due to the interaction of multiple genes
    5·1 answer
  • Which of the following types of models is most likely to be used to predict earthquakes?
    7·2 answers
  • Explain how nucleotide stop molecules created fragments of replicated dna of different lengths
    14·1 answer
  • If enzymes are made up of proteins, then can proteins be considered as monomers to enzymes?
    10·1 answer
  • Which phrase best describes definition diffusion
    11·1 answer
  • Fundamenta la idea, existe vida EXTRATERRESTRE?
    8·1 answer
  • Question: what virus shown shaped as a crystal?<br>Vaccines trigger the production of?​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!