Answer:
Empirical evidence of his ideas
Explanation:
The scientific process involves the formulation of hypotheses that enable to answer questions about the real world, and then to carry out experiments or observations that are used to confirm (or reject) such predictions. In the last 160 years, Darwin's ideas on 'descent with modification' have constantly been subjected to experimental assessment, and obtained data confirmed his observations. For example, molecular evidence based on the DNA and RNA -which constitute the genetic material of all living organisms- has shown the conservation of this process. In consequence, molecular evidence has been used to construct 'evolutionary' phylogenetic trees from DNA/RNA sequences. Moreover, evidence in genetics has shown the critical role played by mutations in the mechanism of natural selection proposed by Darwin, thus also confirming his theories. These are only some examples, and supporting evidence confirming Darwin's ideas has been collected from different research fields ranging from ecology to molecular biology.
It happens during the s phase
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
true
Explanation:
theres a bunch of different categories depending on the subject
Answer:
telophase is the correct answer
Explanation:
sorry if its incorrect.
