1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
polet [3.4K]
3 years ago
7

Which one is odd one out on the basis of respiration: Amoeba, cockroach, earthworm, euglena

Biology
1 answer:
Inga [223]3 years ago
5 0

Answer:

Cockroach is you answer.

Explanation:

They do this by using a very efficient breathing system that uses air filled tubes, called trachea, to deliver oxygen directly to cells. Oxygen flows in as required into the tracheal system through valves on the insect, called spiracles. But, sometimes, they shut their spiracles and stop breathing.

You might be interested in
what kind of animal is this? pls i need an answer quick. it’s head is kind of red and it has two dots on each part of it. pls an
docker41 [41]
Just guessing but it looks like a Caterpillar
6 0
3 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Please answer fast less than 2 hours
never [62]
Taxonomy- the classification of something, especially organisms.

Classify- arrange (a group of people or things) in classes or categories according to shared qualities or characteristics.

Binomial nomenclature- the scientific way to name living things with a two part generic (genus) and specific (species) name.

Kingdom- a country, state, or territory ruled by a king or queen.

Species- a group of living organisms consisting of similar individuals capable of exchanging genes or interbreeding. The species is the principal natural taxonomic unit, ranking below a genus and denoted by a Latin binomial, e.g. Homo sapiens.

Prokaryote- a microscopic single-celled organism which has neither a distinct nucleus with a membrane nor other specialized organelles, including the bacteria and cyanobacteria.

Eukaryote- an organism consisting of a cell or cells in which the genetic material is DNA in the form of chromosomes contained within a distinct nucleus. Eukaryotes include all living organisms other than the eubacteria and archaea.

Heterotroph- an organism deriving its nutritional requirements from complex organic substances.

Autotroph- an organism that is able to form nutritional organic substances from simple inorganic substances such as carbon dioxide.

Unicellular- having or consisting of a single cell.

Multicellular- composed of several or many cells.

Hope this helps
8 0
2 years ago
Which of the following describes the function of genomics and marker-assisted selection?
Softa [21]

Answer:

D

Explanation:

Improve desirable traits and help determine the heritability of a trait.

5 0
3 years ago
How do peppered moths after the Industrial Revolution show the process of natural selection?
Anni [7]
A. The black moths were more fit for survival, so their phenotype frequency increased.

I just did a project over this in biology and kinda hated it lol but there's the answer, have a gr8 day m8
6 0
2 years ago
Read 2 more answers
Other questions:
  • Rowan is doing a project on soft corals. Which is the correct way for Rowan to describe soft corals?
    11·2 answers
  • Draw a punnett square in your laboratory journal that illustrates the likelihood that a man with fh and a woman who is unaffecte
    5·1 answer
  • During which stage of interphase does the cell make additional proteins and organelles in its last preparations for cell divisio
    10·1 answer
  • All of the following are found in a chloroplast EXCEPT
    13·2 answers
  • Select all that apply. Which of the following are characteristics of Cnidaria? radial symmetry acoelomates bilateral symmetry co
    15·2 answers
  • Nearly all of the plant tissue called ____ is made up of cell walls.
    10·1 answer
  • Drag the tiles to the correct boxes to complete the pairs.
    10·2 answers
  • Write a research-based argumentative essay for or against the importance of standing up to an injustice such as bullying.
    14·2 answers
  • Which best describes the plant?
    7·1 answer
  • What process adds carbon dioxide to the air
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!