Answer:
if the results are efficient in answering the problems raised in the research and if they manage to come to terms with the hypotheses.
Explanation:
As you may know, scientific research must be done through several steps that allow an experiment to be carried out in order to reach conclusions on a certain topic.
In research on the carbon cycle and global warming, it is necessary for the researcher to raise problems and questions about this topic, as well as to raise hypotheses that must be directly related to the results of the experiment. If the result of the experiment is efficient in answering the research problems and questions, in addition to being able to agree with the presented hypotheses, it means that the research has value within the scientific branch in which it fits, in addition to showing that the experiment was done correctly.
Answer:
B. Simple Cuboidal
Explanation:
Because the simple cuboidal epithelium consists of a single layer of cells that are as tall as they are wide. The important functions of the simple cuboidal epithelium are secretion and absorption. This epithelial type is found in the small collecting ducts of the kidneys, pancreas, and salivary glands.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Hibernation is a way animals conserve energy to survive adverse weather conditions or lack of food.
Unlike freshwater fish, saltwater fish <span>often contain a lower concentration of salt than the water they live in.
so your answer is </span><span>A. often contain a lower concentration of salt than the water they live in.
hope that helps!!!!!</span>
