1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inessss [21]
3 years ago
10

Does any one know the answer to this because I do not

Biology
2 answers:
jekas [21]3 years ago
5 0
I’m pretty sure that it’s plants
inessss [21]3 years ago
3 0

Answer:

I think its Pioneer Species

Explanation:

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Which symptom is unique to amyotrophic lateral sclerosis (als) and is not observed in multiple sclerosis (ms)?
Nonamiya [84]

ALS is a rapidly progressive and fatal neuromuscular disease. MS is a scarring and hardening of the sheath around the nerves in the brain, spinal cord, and optic nerve. MD is a muscular disorder with specific kinds of MD involving different muscles in the body. MD is almost exclusively hereditary

<h3>What is Amyotrophic lateral sclerosis (als) ?</h3>

The motor neurons steadily degrade and eventually die as a result of ALS. The brain, spinal cord, and all the muscles in the body are connected by motor neurons. When motor neurons are destroyed, they stop communicating with the muscles, which prevents the muscles from working.

  • Five to ten percent of all ALS cases are familial, meaning the patient gets the illness from a parent. Typically, only one parent needs to have the disease-causing gene to have familial ALS.

Learn more about Amyotrophic lateral sclerosis here:

brainly.com/question/14863487

#SPJ4

4 0
1 year ago
The component of a homeostatic control system which transmits the response is called the .
borishaifa [10]

The homeostatic control system component which transmits the response is called the receptor.

To add, the receptor is <span>an organ or cell able to respond to light, heat, or other external stimulus and transmit a signal to a sensory nerve.</span>

4 0
3 years ago
What is wolf biology
KonstantinChe [14]
It’s Wolf biologists are a specific type of wildlife biologist - a scientist employed to observe and study animal behaviors. In this case, their research and study are limited to wolves. They spend time in the field observing the wildlife and their interactions with each other, prey animals and the ecology.
3 0
2 years ago
What is the source of the oxygen released into the air as a product of photosynthesis?
Rudiy27
The source of the oxygen released into the air as a product of photosynthesis is C) Water only.
4 0
3 years ago
Other questions:
  • Through evolution studies, __________ realized blending wasnt major importance in inheritance A. Hippocrates B. Gregor mendel C.
    7·1 answer
  • What is true about the relationship of adenine and thymine
    13·1 answer
  • Darwin's ideas espoused in both Origin of Species and The Descent of Man were incompatible with the prevalent scientific racism
    8·1 answer
  • What are cumulonimbus clouds?
    14·1 answer
  • Plz help help help help
    14·1 answer
  • Number of eyes found in earthworm​
    8·2 answers
  • ______ is a non-specific response to disease, in which the body temperature rises.
    15·2 answers
  • Fax about blue eyes i don't mind two BRAINLES​
    15·2 answers
  • mutations in dna may or may not result in a change in the phenotype of an organism. in which of the following situations will a
    8·1 answer
  • An infection that occurs when a microbe breaks loose from a localized infection and is carried by the circulation to another tis
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!