1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
igor_vitrenko [27]
3 years ago
14

Which of the following describes all animals? A. All animals have backbones. B. All animals are multicellular. C. All animals co

ntrol their own body temperature. D. All animals are vertebrates.
Biology
2 answers:
alex41 [277]3 years ago
7 0

Answer:

B, definitely B.

Explanation:

Elanso [62]3 years ago
3 0

Answer:

b

Explanation:

You might be interested in
Farmers are not able to rely on rainfall to meet the water needs for their crops.
Rzqust [24]

Answer:

True

Explanation:

That's why modern-day farmers use giant sprinklers and tractor water tanks and trucks!

Glad I could help!!

3 0
3 years ago
Read 2 more answers
Select all that apply . What are the waste products of respiration ?
Morgarella [4.7K]
The waste products of respiration are Co2 and H20.
6 0
3 years ago
Emt people answer these what are the answers to these
anzhelika [568]

Answer:

every answer of yours is correct

8 0
3 years ago
Read 2 more answers
Describe how proteins form (polypeptide)
Natalka [10]

Answer: Atoms were created after the Big Bang 13.7 billion years ago. As the hot, dense new universe cooled, conditions became suitable for quarks and electrons to form. Quarks came together to form protons and neutrons, and these particles combined into nuclei.

3 0
2 years ago
Read 2 more answers
The mitochondrion, like the nucleus, has two or more membrane layers. How is the innermost of these layers different from that o
tensa zangetsu [6.8K]

Answer:

The double membrane of the mitochondria is highly folded,and therefore wider when unfolded than that of the nucleus.This is an adaptive feature  to increase the surface area for reactions (electrochemical  gradient) by accommodating protons pumped into it by the proton motive force(PMF)  from the matrix to set up the electrochemical gradients needed to generate the energy needed by ATPase synthase enzymes for ATPs synthesis.

Required number of protons needed to be accommodated by the double membrane to generate enough energy for ATPase synthesis,therefore larger surface area is needed.

Explanation:

5 0
3 years ago
Other questions:
  • Which of these elements is found in both carbohydrates and water?
    7·2 answers
  • How many groups did Aristotle use to divide all of the organisms in the world?
    9·2 answers
  • To acquire iron as a critical nutrient, pathogenic bacteria _________. invade cells in order to access iron within degradative l
    14·1 answer
  • Que tipo de celula es un virus
    11·1 answer
  • What is the correct answer?
    10·2 answers
  • Will mark Brainliest!!!
    7·1 answer
  • 4. Asexual reproduction in cells produces two identical daughter cells.<br> True<br> O False
    6·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Which three continents contain coal fields that provide evidence for continental drift?
    5·2 answers
  • Treatment of laryngitis includes:
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!