1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dsp73
3 years ago
15

At low temperatures, a particular enzyme catalyzes a reaction, but at a slow rate. At high temperatures, the enzyme is completel

y inactive. What statement best explains the difference in how temperature affects the function of this enzyme?
Biology
1 answer:
Orlov [11]3 years ago
5 0

At the low temperature, a particular enzyme catalyses a reaction best explains temperature affects the function of this enzyme.  

Explanation:

Enzymes are those catalysts which is generally proteins through some RNA molecules as enzymes too.  The activation energy of reaction of Enzymes lower is required amount of energy which is needed for occurring the reaction.

Temperature, pH and concentration affect the Enzyme activity. The raising of temperature generally speeds up the reaction. Due to high temperature enzyme to lose its shape and stop working.  The part of enzyme where substrate bind is called the active site.  

You might be interested in
: which nutrient class is used to build body tissues and make enzymes? lipids proteins vitamins carbohydrates
Nata [24]
Proteins is correct.....

please vote my answer brainliest. thanks!
8 0
3 years ago
PLSS HELP
densk [106]

Explanation:

Primary succession, type of ecological succession (the evolution of a biological community’s ecological structure) in which plants and animals first colonize a barren, lifeless habitat. Species that arrive first in the newly created environment are called pioneer species, and through their interactions they build a simple initial biological community. This community becomes more complex as new species arrive. Primary succession is distinguished from secondary succession, which is the recovery of an existing biological community after a disturbance sets back the community’s ecological structure to an earlier stage.

6 0
3 years ago
What is the procedure for genetic trantformation
Diano4ka-milaya [45]

Answer:

Translocation

Explanation:

7 0
3 years ago
Which factor would contraindicate the use of disulfiram in the treatment of a client who has an alcohol use disorder?
vodka [1.7K]

Answer;

The client had six drinks a few hours ago.

Explanation;

-Disulfiram is used to treat chronic alcoholism. It causes unpleasant effects when even small amounts of alcohol are consumed.

-The drug can stay in the body for up to two weeks and can make patients feel sick any time they consume alcohol during that period. In fact, alcohol ingestion has been known to produce the same unpleasant effects 1-2 weeks after a person has taken her last dose of disulfiram.

6 0
3 years ago
..If two solutions are isotonic to each other, then...
Naily [24]

Answer:

They have the same concentration.

Explanation:

Isotonic, by definition, means that the two solutions are of equal concentration

8 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Large doses of antibiotics given to fight an infection are likely to destroy bacteria that produce vitamin K. In which digestive
    13·1 answer
  • What is the study of geology an meterology
    10·1 answer
  • Mitosis and meiosis are processes by which animal and plant cells divide. which statement best describes a difference between mi
    9·2 answers
  • Which two organs help break down food mechanically
    8·1 answer
  • A biologist is studying the possible role of earthworms on the fertility of farm soils. As part of this research, the number of
    7·1 answer
  • Socialization only happens within the family?<br> true<br> false
    13·1 answer
  • According to the theory of _______, most of Earth's current species developed from distinctly different species which existed ea
    15·2 answers
  • In older bird guides, the Audubon warbler and the myrtle warbler were classified as two separate species. For many decades, the
    13·2 answers
  • Compare the leaf hairs on the upper leaf surface with the leaf hairs on the lower leaf surface.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!