1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
7nadin3 [17]
3 years ago
12

2 poin

Biology
1 answer:
Tasya [4]3 years ago
7 0

Answer: Digestive and respiratory

Explanation:

Digestive system provides glucose and the Respiratory system provides oxygen, both are reactants for cellular respiration.

You might be interested in
Which of the following statements about soil formation is true?
Kisachek [45]

B. Precipitation affects the rate at which nutrients are removed from soil.

Soil is known to be a loose mixture of rock fragments, water, organic materials and air that  usually accommodate the growth of vegetation. Thus, formation and development of soil is a dynamic process rather than static and soil is present when pre-historic animals roamed the Earth and some these animals are preserved only fossilized soils buried deep beneath our present soil.

6 0
3 years ago
Read 2 more answers
_____ are a group of organic compounds including fats, phospholipids, and steroids.
Dennis_Churaev [7]

Lipids are a group of organic compounds including fats, phospholipids, and steroids.

Lipids are a group of organic compounds that do not dissolve easily with water. Lipids include fats, oils, monoglycerides, diglycerides, triglycerides, phospholipids, hormones, vitamins (such as vitamins A, D, E, and K), and steroids. Lipids functions by storing energy for organisms, as chemical messengers between cells, tissues, and organs, and they also function as structural parts of cell membranes.

4 0
3 years ago
Read 2 more answers
Why is it ineffective to treat viral disease with antibiotics?
barxatty [35]

Antibiotics inhibit enzymes specific to bacteria and have no effect on vi-rally

encoded enzyme.

5 0
3 years ago
Which unit of measurement should be used to describe the mass of a apple
Andreyy89
Grams should be an appropriate unit to measure an apple. It is a metric unit and is usually used for the mass of an object
4 0
3 years ago
Which of the following protist groups correctly completes the sentence below?
Schach [20]

Amoeba are the consumers that surround, engulf, and ingest their food.

<h3><u>Explanation</u>:</h3>

Amoeba is a unicellular organism that belongs to the kingdom Protista. This organism are having eukaryotic cells without any cell walls. These organisms have each and every cellular organelle that are needed to perform metabolism.

Amoeba are consumer in mode of nutrition. Whenever they senses some food, they push a part of their cytoplasm packed in cell membrane towards the food to cover it. This process is called pseupodia.

This pseupodia engulfs the food and performs phagocytosis or pinocytosis. This food is covered in a cell membrane inside the cytoplasm which is called the food vacoule or endosome. This then fuses with a lysosome to digest and then the excretory product is let off by the secondary vacoule.

8 0
3 years ago
Read 2 more answers
Other questions:
  • What body cavities are located superior to the diaphragm
    6·1 answer
  • Which of the following is NOT a characteristic of minerals
    15·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • In humans, MITOSIS directly accomplishes all of the following EXCEPT
    10·1 answer
  • What is a joint? describe the function of movable joints in the body?
    15·1 answer
  • Who some people leave their homes in Mexico
    5·2 answers
  • The basic unit of structure and function in the nervous system is
    11·1 answer
  • 1: explain if ocean waves can be considered waves?
    13·1 answer
  • A scientist observes rock masses that have moved past each other in opposite horizontal directions. Which feature does the scien
    7·2 answers
  • In an energy pyramid, the amount of available energy<br> as you move from the bottom to the top.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!