1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xenn [34]
3 years ago
14

What is a substance's melting point?

Chemistry
2 answers:
mixer [17]3 years ago
8 0
Depends on what the substance is
TEA [102]3 years ago
5 0

A melting point of a substance is a point at which the sample or substance start converting in liquid. For most substances, melting and freezing points are approximately equal. For example, the melting point and freezing point of mercury is 234.32 kelvins (−38.83 °C or −37.89 °F). Hope this helped!! :)

You might be interested in
What does the formula H2O mean
forsale [732]
2 hydrogen and 1 oxygen makes water
3 0
3 years ago
Read 2 more answers
Will mark as Brainliest.
stealth61 [152]
The answer you are looking for is A. If you need me to show you how I got the answer let me know. :)
3 0
3 years ago
a 25.0-ml volume of a sodium hydroxide solution requires 19.6 ml of a 0.189 m hydrochloric acid for neutralization. a 10.0- ml v
Rashid [163]

<u>Concentration of NaOH = 0.148 molar, M</u>

<u>Concentration of H3PO4 = 0.172 molar, M</u>

<u></u>

Concentration x Volume  will give the number of moles of solute in that volume.  C*V = moles

Concentration  has a unit of (moles/liter).  When multiplied by the liters of solution used, the result is the number of moles.

Original HCl solution:  (0.189 moles/L)*(0.0196 L)= 0.00370 moles of HCl

The neutralization of 25.0 ml of sodium hydroxide, NaOH, requires 0.00370 moles of HCl.  The reaction is:

  NaOH + HCl > NaCl and H2O

This balanced equation tells us that neutralization of NaOH with HCl requires the same number of moles of each.  We just determined that the  moles of HCl used was 0.00370 moles.  Therefore, the 25.0 ml solution of NaOH had the same number of moles:  0.00370 moles NaOH.

The 0.00370 moles of NaOH was contained in 25.0 ml (0.025 liters).  The concentration of NaOH is therefore:  

    <u>(0.00370 moles of NaOH)/(0.025 L) = 0.148 moles/liter or Molar, M</u>

====

The phosphoric acid problem is handled the same way, but with an added twist.  Phosphoric acid is H3PO4.  We learn the 34.9 ml of the same NaOH solution (0.148M) is needed to neutralize the H3PO4.  But now the acid has three hydrogens that will react.  The balanced equation for this reaction is:

  H3PO4 + 3NaOH = Na3PO4 + 3H2O

Now we need <u><em>three times</em></u> the moles of NaOH to neutralize 1 mole of H3PO4.

The moles of NaOH that were used is:

  (0.148M)*(0.0349 liters) = 0.00517 moles of NaOH

Since the molar ratio of NaOH to H3PO4 is 3 for neutralization, the NaOH only neutralized (0.00517)*(1/3)moles of H3PO4 = 0.00172 moles of H3PO4.

The 0.00172 moles of H3PO4 was contained in 10.0 ml.  The concentration is therefore:

     (0.00172 moles H3PO4)/(0.010 liters H3PO4)

<u>Concentration of H3PO4 = 0.172 molar, M</u>

 

5 0
11 months ago
Why do engineers use metals in making<br> electrical wires
Montano1993 [528]

Answer:

Why is copper used for most electrical wiring? All metals have some amount of resistivity to electrical currents, which is why they require a power source to push the current through. The lower the level of resistivity, the more electrical conductivity a metal has

4 0
3 years ago
Which would most likely cause a person to produce antibodies?
rosijanka [135]

Answer:

receiving a vaccination

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • Homework 3 Write the balanced equations. Calculate how many grams of each reactant will be needed to obtain 100.0 grams of the i
    7·1 answer
  • What part of the ear is damaged most easily by continued exposure to loud noise?
    9·1 answer
  • What information do the chemical hazard label and msds have in common
    13·1 answer
  • Cuál será la masa molar de una sustancia donde 7 g equivalen a 0,25 mol
    6·1 answer
  • Explain why the grams of the nutrient molecules in a food do not add up to the total gram weight of the food.
    8·2 answers
  • Limiting Reactant problem
    8·1 answer
  • Asappp plzz help mee
    12·1 answer
  • What charge would you expect for an formed by Ca?
    8·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Please help, I don't know the formulas to do these and I'd like to know HOW y'all get the answers...thank you so much.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!