1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
prohojiy [21]
3 years ago
10

Why is clear urging an especially damaging forestry practice for species that rely upon older trees for their survival

Biology
2 answers:
Elena-2011 [213]3 years ago
6 0

Answer:

'Genetics in Swedish forestry practice' -- subject(s): Afforestation, Forests and forestry, Genetics

'Den oligarchs astringency och partaken' -- subject(s): Afforestation, Forests and forestry, Genetics, Trees

Explanation:

Masja [62]3 years ago
5 0
How old, is the tree, and does this represent any kind of graph?
You might be interested in
Which of the following is not a similarity between green algae and plants
Dafna11 [192]
Do you have options to pick from
4 0
3 years ago
There are two humans, three dogs, two birds, five cats and a spider
VladimirAG [237]

Answer:

the answer is 48

4+12+4+20+8

I saw this question and I thought it was cool

4 0
2 years ago
When an animal runs along the ground by flexing some of its muscles, what causes its muscles to contract?
ira [324]
Letter A for sure! Hope I helped.
8 0
3 years ago
Read 2 more answers
15. Which of the following are considered sources of "Chemical
Alja [10]

Answer:

its probably

D. all the above

Explanation:

-

8 0
2 years ago
Get these right, earn a follow and respect
IgorLugansk [536]

1. B

2.B

3.A

4.C

5.A

6.C

(i think)

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which sentence best describes the role of RNA?
    13·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • How do you call a balance in which the rate of change in one direction is equal to the rate of change in another?
    6·1 answer
  • How the does the shape of an enzyme affect the reaction?
    7·1 answer
  • A student set up an experiment to show the effect of light color on photosynthesis in Elodea plants. She filled three test tubes
    8·1 answer
  • 15. DNA replication is said to be semi-conservative. What does that mean?
    6·1 answer
  • __________ constitutes about 80% of circulating antibodies in plasma.
    6·1 answer
  • Extra credit - My favorite cactus is Peniocereus greggi var. transmontanus, a night blooming cereus that has a gorgeous white fl
    10·1 answer
  • How does Pteromyzon differ from scolidon and labeo fishes?
    13·1 answer
  • What is the biggest artery in the body?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!