Answer:
Greco-Roman world
Explanation:
The Mediterranean world which comprises of areas around the land regions of the Mediterranean and Black Sea Basins were influenced in various forms such as culture, language and the style of government by the Greeks and Romans.
These people were majorly involved in the civilization of the Mediterranean region. This makes the Mediterranean world to also be called the Greco-Roman world.
Answer:
Gasoline fuel is used for running automobiles.
Explanation:
During respiration, the breakdown of glucose undergoes several steps in order to produce ATP, namely in glycolysis, the Kreb's cycle and oxidative phosphorylation.
overall: C6H12O6 (glucose) + 6 O2 → 6 CO2 + 6 H2O + ≈38 ATP
Further Explanation:
In all eukaryotic cells mitochondria are small cellular organelles bound by membranes, these make most of the chemical energy required for powering the biochemical reactions within the cell. This chemical energy is stored within the molecule ATP which is produced. Respiration in the mitochondria utilizes oxygen for the production of ATP in the Krebs’ or Citric acid cycle via the oxidization of pyruvate( through the process of glycolysis in the cytoplasm).
Oxidative phosphorylation describes a process in which the NADH and FADH2 made in previous steps of respiration process give up electrons in the electron transport chain these are converted it to their previous forms, NADH+ and FAD. Electrons continue to move down the chain the energy they release is used in pumping protons out of the matrix of the mitochondria.
This forms a gradient where there is a differential in the number of protons on either side of the membrane the protons flow or re-enter the matrix through the enzyme ATP synthase, which makes the energy storage molecules of ATP from the reduction of ADP. At the end of the electron transport, three molecules of oxygen accept electrons and protons to form molecules of water...
- Glycolysis: occurs in the cytoplasm 2 molecules of ATP are used to cleave glucose into 2 pyruvates, 4 ATP and 2 electron carrying NADH molecules. (2 ATP are utilized for a net ATP of 2)
- The Citric acid or Kreb's cycle: in the mitochondrial matrix- 6 molecules of CO2 are produced by combining oxygen and the carbon within pyruvate, 2 ATP oxygen molecules, 8 NADH and 2 FADH2.
- The electron transport chain, ETC: in the inner mitochondrial membrane, 34 ATP, electrons combine with H+ split from 10 NADH, 4 FADH2, renewing the number of electron acceptors and 3 oxygen; this forms 6 H2O, 10 NAD+, 4 FAD.
Learn more about cellular life at brainly.com/question/11259903
Learn more about cellular respiration at brainly.com/question/11203046
#LearnWithBrainly
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
The scientific method involves deriving hypotheses from theories and then testing those hypotheses. If the results are consistent with the theory, then the theory is supported. If the results are not consistent, then the theory should be modified and new hypotheses will be generated.
