1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IceJOKER [234]
3 years ago
10

What order do these go?

Biology
1 answer:
Marianna [84]3 years ago
8 0

Answer:

3 5 4 2 1 i hope this helps you

You might be interested in
The heron has long legs so that it can walk in the shallow water and catch fish.what is this type of adaptation called?​
nignag [31]

Answer:

Aquatic Adaptation

7 0
3 years ago
Describe how a metamorphic rock might become a sedimentary rock over time.
wlad13 [49]
It can become a sedimentary rock over time because of weathering. sedimentary rocks are rocks that have been broken down over time by water and erosion. hope this helps.
4 0
3 years ago
Which of the following accurately describes the structure of an atom? Question 6 options: Protons are in the nucleus, with elect
aniked [119]

Answer:

dear user

the answer is option no.1 protons are in the nucleus and ,with electrons and neutrons orbiting the nucleus

5 0
3 years ago
Why is it necessary to eliminate absolutely all invasive fire ant colonies to eradicate the invasive population?
Rainbow [258]

Answer:

d.  Fire ants spread by winged members and by hitching rides so a single colony can cause infestation.

Explanation:

An invasive fire ant colony can be very disastrous to the population of organisms in a locality. They cause massive competition with the native species thereby infesting them and destroying the native population.

Fire ants spread by winged members which makes a single colony to cause severe damage to the native specie. Often times, as they become endemic, they manifest as the dominant specie in a particular location.

4 0
2 years ago
Read 2 more answers
When consumed together, grains and legumes are good complementing protein sources?
lana [24]
The statement that when consumed together, grains and legumes are good complementing protein sources is true.<span> 
</span><span>Legumes are plants that include beans, lentils, peas and peanuts, while grains are </span><span>wheat, oats, corn, rice..</span><span>
They are less expensive than meat, poultry and fish.
</span>When eaten together provide a complete protein essential for health.
4 0
3 years ago
Other questions:
  • Why are small rocks more susceptible to chemical weathering?
    6·1 answer
  • Diseases carried from person to person through other hosts, such as animals or insects, are known as _____
    6·1 answer
  • What technological advancement helped people learn about cells?
    11·1 answer
  • Analyze what surface features of the Moon reveal about its history.
    15·1 answer
  • What term is used to describe the movement of the ankle that results in the top of the foot moving toward the anterior tibia in
    13·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What is transcription?
    11·2 answers
  • PLEASE HELP
    14·1 answer
  • What are the functions of plasma membrane??<br><br><br><br>btw hii​
    13·1 answer
  • The most critical element of the biofeedback process is: Group of answer choices change in rate of breathing. immediate informat
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!