1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga nikolaevna [1]
3 years ago
6

Sequence A: methionine, phenylalanine, threonine

Biology
1 answer:
Mrrafil [7]3 years ago
5 0

Answer:

There are no results for

Explanation:

You might be interested in
**Brainiest if correct**
Anna007 [38]
Snakes can live up to 9 years. They slither up to 18 mph. Snakes are reptiles that are elongated, limbless, and carnivorous. Another interesting thing about snakes is that they don’t have eyelids. The last fact is that snakes can open there mouths up to 150 degrees so they can swallow there prey.
4 0
3 years ago
A client who had a transurethral resection of the prostate is transferred to the postanesthesia care unit with an intravenous (i
kari74 [83]

<span>The nearness of an indwelling urinary catheter and a ceaseless bladder water system are standard postoperative desires after a TURP; they accommodate hemostasis and urinary discharge. A stomach entry point and dressing are available with a suprapubic, not transurethral, prostatectomy. After a TURP the customer at first can expect hematuria and some blood coagulations; the persistent bladder water system keeps the bladder free of clumps and the catheter patent.</span>

6 0
3 years ago
A _____ country has high population density.
nadezda [96]

Answer:

A. A Densley populated country.

Explanation:

8 0
3 years ago
The movement of ocean currents around the globe? Check all that apply. Strong winds force warm water to sink to the ocean floor.
zysi [14]

Answer:

Cool dense water sinks to the ocean floor.

Warm water replaces cool surface water.

Wind blowing parallel to the shore causes upwelling of cool water.

3 0
3 years ago
2. what is the main source of energy for plants and animals? coursehero
gavmur [86]

Answer:

The Sun is the major source of energy

pls mark brainliest. thank you

3 0
3 years ago
Read 2 more answers
Other questions:
  • a cell phone company charges $40 per month for unlimited calling and $0.20 per text message sent it to you represents the number
    5·1 answer
  • Which is a heterogeneous mixture? the water, vinegar, and dye mixture used to make colored eggs the mixture of gases in the air
    12·2 answers
  • What is transport sugar
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • A small river forms, dividing a group of moles into two isolated populations. After many years, biologist puts moles from opposi
    9·1 answer
  • Is b the correct answer?
    8·1 answer
  • Which of these terms refers to tissue that forms from abnormal cell division?
    15·1 answer
  • Indetify the atmospheric layer within which most of the volcanic ash was transported
    9·1 answer
  • 3. How has the distribution of forests changed over time in the United States?<br> STT
    15·1 answer
  • Explain the changes that happen in the body before and after exercise
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!