1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
notka56 [123]
4 years ago
5

If x can be any number, how many solutions are there for the equation?

Mathematics
1 answer:
maw [93]4 years ago
8 0
There are many solutions, and that's an understatement. There are actually an infinite number of solutions.
You might be interested in
Suppose that profit for a particular product is calculated using the linear equation: Profit = 20S + 3D. Which of the following
uranmaximum [27]

Answer:

b. S = 405, D = 0

Step-by-step explanation:

We have been given that profit for a particular product is calculated using the linear equation: \text{Profit}=20S+3D. We are asked to choose the combinations of S and D that would yield a maximum profit.

To solve our given problem, we will substitute given values of S and D in the profit function one by one.

a. S = 0, D = 0

\text{Profit}=20S+3D

\text{Profit}=20(0)+3(0)

\text{Profit}=0

b. S = 405, D = 0

\text{Profit}=20S+3D

\text{Profit}=20(405)+3(0)

\text{Profit}=8100+0

\text{Profit}=8100

c. S = 0, D = 299

\text{Profit}=20S+3D

\text{Profit}=20(0)+3(299)

\text{Profit}=0+897

\text{Profit}=897

d. S = 182, D = 145

\text{Profit}=20S+3D

\text{Profit}=20(182)+3(145)

\text{Profit}=3640+435

\text{Profit}=4075

Since the combination S = 405, D = 0 gives the maximum profit ($8100), therefore, option 'b' is the correct choice.

7 0
3 years ago
PLSSS HELP WITH THIS ONE !!! MARKING AGAIN THE BRAINLIST ANSWER!!!
Levart [38]

Answer:

Step-by-step explanation:

He earned $15.20. Just multiply the 2.00x4 and the 2.40x3

3 0
3 years ago
A painting measures b meters by 4 meters. a frame shop charges $10 per meter for a wooden frame. how much would it cost to buy a
hammer [34]

$ (20b + 80) is the cost to buy a frame for the panting given that measures b meters by 4 meters and charges $10 per meter for a wooden frame. This can be obtained by finding the perimeter of the painting and multiplying with the cost of wood per meter.

<h3>What is the cost of buying a frame for the painting?</h3>

Given that,

length of the painting (l) = b meters

width of the painting (b) = 4 meters

Perimeter of the painting = 2(l+b)

                                          = 2(b+4)

                                          = 2b + 8

Cost of the frame = (2b + 8)× $10 per meter

                             = $ (20b + 80)

Hence $ (20b + 80) is the cost to buy a frame for the panting given that measures b meters by 4 meters and charges $10 per meter for a wooden frame.

Learn more about finding cost of frame:

brainly.com/question/16757070

#SPJ4

4 0
2 years ago
Bobby decides to sell lemonade on a hot summer day. If Bobby sells 20 glasses of lemonade for $0.20 per cup, and his average tot
borishaifa [10]

Answer:

Bobby's economic profits for the day is $0.60.

Step-by-step explanation:

Bobby sells 20 glasses of lemonade for $0.20 per cup.

Amount earned = 20\times0.20=4 dollars

The average total cost is $0.17.

So, difference in selling amount and average = 0.20-0.17=0.03 dollars

Therefore, Bobby's economic profits for the day is = 20\times0.03=0.60 dollars

Hence, the answer is $0.60.

5 0
4 years ago
Workers are fencing off a rectangular construction zone before they begin work. The length of the construction zone is 5 meters
ivolga24 [154]
You cant answer this question there isnt enough info

4 0
3 years ago
Read 2 more answers
Other questions:
  • Estimate the area of the parallelogram.
    5·1 answer
  • A library has at least 900 square feet to create a new study area. Each study cubicle uses 6 square feet, and each computer stat
    10·1 answer
  • Write the pair of fractions 3/10 and 1/2 as a pair of fractions with a common denominator
    11·1 answer
  • Select the equation of the line parallel to the equation 2x + 4y = -5 that passes through the point (-4, -8).
    10·1 answer
  • What is the third quartile of this data set 20,21,24,25,28,29,35,36,37,43,44
    6·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • If sin tetha=root3/2, what is cos tetha?​
    7·1 answer
  • What is the area of a rectangular driveway measuring 20 feet long and 15 feet wide?<br>​
    15·1 answer
  • Find the area of the shaded region
    7·1 answer
  • Use Newton’s Method to find the solution to x^3+1=2x+3 use x_1=2 and find x_4 accurate to six decimal places. Hint use x^3-2x-2=
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!