1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vinvika [58]
3 years ago
5

All vertebrates have bilateral symmetry and a true coelom. At the base of the phylogenetic tree, neither sponges nor cnidarians

have a coelom. Sponges have an asymmetric body plan; cnidarians have radial symmetric plan. What advantages do the bilateral symmetry and the coelom give to animals?
Biology
1 answer:
yanalaym [24]3 years ago
8 0

Answer:

Bilateral symmetry allows for directional motion. The coelom cushions organs allow freedom of motion.

Explanation:

Most animals are bilaterally symmetrical in nature with a line of symmetry dividing their body into two sides left and right sides along-with a “head” in top and “tail” in the bottom. Bilateral symmetry consisting an equal arrangement of symmetry about a vertical plane running from top to bottom.

The coelom is known as the main body cavity present in most animals. It is positioned inside the body to surrounds the digestive tract and other organs. In some animals, it is lined with mesothelium. In other animals, such as mollusks, it is undifferentiated. In animals, it helps to allow freedom of motion.

You might be interested in
3. All of the energy within an ecosystem originates from the _______________.
EastWind [94]
Originates from the sun.
7 0
3 years ago
Read 2 more answers
What is a substance that cannot be broken down into other substances by chemical reactions?
vovikov84 [41]
Element 
An element is a pure substance that cannot be broken down into other substances, an element is made up of only one type of atom. 
Hope this helps :) 
3 0
3 years ago
With the exception of the 12 cranial nerves, other major nerves exit the brain through the:
Oksana_A [137]
I think the answer should be medulla oblongata or foramen magnum.

The major nerves that leave brain should form a thick cord in the brain stem that called medulla oblongata. Medulla oblongata will pass a big hole in the base of the skull that called foramen magnum. Depends on what part the question asked(bone or tissue), it probably between those two options.
3 0
3 years ago
Which element is the main component of all organic molecules?
Zigmanuir [339]
Carbon ^^ is the answer if I’m not mistakenn
4 0
2 years ago
When it was time to go outdoors, 3-year-old Casandra said she didn’t want to play and headed for her locker. At the teacher’s ge
kirza4 [7]

Answer:

casandra was scared around others

Explanation:

in the passage i notesed that she went to her locker and started crying

6 0
3 years ago
Read 2 more answers
Other questions:
  • Scientists use existing fossils to predict what the transitional forms between organisms might look like. Why might it be so har
    8·1 answer
  • An ocean wave is an example of a(n) _____ wave form. transverse longitudinal compression circular
    13·2 answers
  • A glomerulus is
    6·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What is the likely reason that bees and wasps become extinct
    7·1 answer
  • Label the image with the type of plant used in the bouquet.
    6·1 answer
  • What is the activities of life that occur the cellular level​
    8·1 answer
  • HELPPP PLEASE!!! WILL GIVE BRAINLIEST AND 50 PIONT!!!!!
    10·1 answer
  • PLEASE HELP MEEEEE
    12·2 answers
  • The ______ partially forms the posterior roof of the diencephalon and covers the third ventricle.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!