1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xz_007 [3.2K]
3 years ago
14

Which option is a balanced equation for photosynthesis?

Biology
1 answer:
Eva8 [605]3 years ago
7 0

Answer:6CO2 + 6H2O -> C6H12O6 + 6O2

Explanation: Photosynthesis is a process by which green plants use energy from the sun to manufacture their own food from carbon dioxide and water. In the reaction, 6 molecules of water combines 6 molecules of carbon dioxide to form one molecule of glucose and 6 molecules of oxygen.

The equation for the reaction is shown below

6CO2 + 6H2O --> C6H12O6 + 6O2

In balancing a chemical equation, the total mass of the reactants must be equal to the total mass of the products because law of conservation of mass states that matter can neither be created nor be destroyed in an ordinary chemical reaction.

You might be interested in
How is the size of a planet related to the thickness of its atmosphere? explain.
a_sh-v [17]
The amount of gravitational pull helps determine the gases that can form an atmosphere around a large body in space. So the mass of an object also determines the density of these gases. Note that several factors come into effect for a large object to sustain their gases if present.
5 0
3 years ago
Read 2 more answers
What would you make if you added CO2, water and energy?
icang [17]

Answer:

Glucose?

Explanation:

3 0
2 years ago
What will happen to the frequency of the recessive allele for the hbs gene when there is an outbreak of malaria? the frequency w
Ad libitum [116K]

In the outbreak of malaria, the frequency of the recessive allele for the HbS gene will increase. The correct option is A.

<h3>What is the HbS gene?</h3>

HbS is a beta-globin gene known as sickle hemoglobin.

It causes sickle cell disease in humans.

The disease is expressed by two HbS variants or one HbS variant or one another beta-globin gene.

Malaria is caused by the plasmodium parasite, which is present in the saliva of the mosquito.

Thus, the correct option is A, the frequency will increase.

Learn more about HbS gene

brainly.com/question/14950995

8 0
2 years ago
Read 2 more answers
Why does vultures smell help them? I’m sentience form please
bonufazy [111]

Answer:

!fodkrlpelddksps make

ekepekeprkro prkrk

4 0
2 years ago
Read 2 more answers
Find the difference: 28y − 16y
strojnjashka [21]
The answer is 14y

I think
7 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which of the following is a correct statement? Select one:
    6·1 answer
  • The original parent cell has 7 chromosomes. When the cell divides to create 2 new cells, how many chromosomes will each of its d
    12·1 answer
  • Which statement is mostly likely to apply to a cell that has DNA within it cytoplasm
    6·1 answer
  • According to a recent encyclopedia entry about dog breeds, Labrador retrievers come in two specific breeds: English and American
    6·2 answers
  • Read about symbiosis using this link. Then answer the questions provided. Identify the type of symbiosis described. The saguaro
    14·2 answers
  • If a white flower is crossed with a red flower and all of the offspring are pink flowers, this would be an example of ____.
    6·1 answer
  • PLEASE HELP!!!!!! WILL GIVE BRAINLIEST!!!!!!!
    8·2 answers
  • The development of heart disease is based on a genetic trait. Which action may delay the onset of the disease?
    10·1 answer
  • If the amount of predators in the mice environment increased, the mices carrying capacity would_____. (Increase/Decrease). Becau
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!